ID: 1138425542

View in Genome Browser
Species Human (GRCh38)
Location 16:56929772-56929794
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138425542_1138425545 -4 Left 1138425542 16:56929772-56929794 CCTGCTTCACAGAGATGGGATGT No data
Right 1138425545 16:56929791-56929813 ATGTTGCAATAGGCCAGGCATGG No data
1138425542_1138425546 -1 Left 1138425542 16:56929772-56929794 CCTGCTTCACAGAGATGGGATGT No data
Right 1138425546 16:56929794-56929816 TTGCAATAGGCCAGGCATGGAGG No data
1138425542_1138425544 -9 Left 1138425542 16:56929772-56929794 CCTGCTTCACAGAGATGGGATGT No data
Right 1138425544 16:56929786-56929808 ATGGGATGTTGCAATAGGCCAGG No data
1138425542_1138425549 30 Left 1138425542 16:56929772-56929794 CCTGCTTCACAGAGATGGGATGT No data
Right 1138425549 16:56929825-56929847 TGTACTGCTAGCACTTTTGGAGG No data
1138425542_1138425548 27 Left 1138425542 16:56929772-56929794 CCTGCTTCACAGAGATGGGATGT No data
Right 1138425548 16:56929822-56929844 ATCTGTACTGCTAGCACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138425542 Original CRISPR ACATCCCATCTCTGTGAAGC AGG (reversed) Intergenic