ID: 1138425543

View in Genome Browser
Species Human (GRCh38)
Location 16:56929781-56929803
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138425537_1138425543 16 Left 1138425537 16:56929742-56929764 CCCATTTTGGCTGCTGTCACTGC No data
Right 1138425543 16:56929781-56929803 CAGAGATGGGATGTTGCAATAGG No data
1138425538_1138425543 15 Left 1138425538 16:56929743-56929765 CCATTTTGGCTGCTGTCACTGCA No data
Right 1138425543 16:56929781-56929803 CAGAGATGGGATGTTGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138425543 Original CRISPR CAGAGATGGGATGTTGCAAT AGG Intergenic