ID: 1138425543 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:56929781-56929803 |
Sequence | CAGAGATGGGATGTTGCAAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1138425537_1138425543 | 16 | Left | 1138425537 | 16:56929742-56929764 | CCCATTTTGGCTGCTGTCACTGC | No data | ||
Right | 1138425543 | 16:56929781-56929803 | CAGAGATGGGATGTTGCAATAGG | No data | ||||
1138425538_1138425543 | 15 | Left | 1138425538 | 16:56929743-56929765 | CCATTTTGGCTGCTGTCACTGCA | No data | ||
Right | 1138425543 | 16:56929781-56929803 | CAGAGATGGGATGTTGCAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1138425543 | Original CRISPR | CAGAGATGGGATGTTGCAAT AGG | Intergenic | ||