ID: 1138425546

View in Genome Browser
Species Human (GRCh38)
Location 16:56929794-56929816
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138425541_1138425546 0 Left 1138425541 16:56929771-56929793 CCCTGCTTCACAGAGATGGGATG No data
Right 1138425546 16:56929794-56929816 TTGCAATAGGCCAGGCATGGAGG No data
1138425538_1138425546 28 Left 1138425538 16:56929743-56929765 CCATTTTGGCTGCTGTCACTGCA No data
Right 1138425546 16:56929794-56929816 TTGCAATAGGCCAGGCATGGAGG No data
1138425537_1138425546 29 Left 1138425537 16:56929742-56929764 CCCATTTTGGCTGCTGTCACTGC No data
Right 1138425546 16:56929794-56929816 TTGCAATAGGCCAGGCATGGAGG No data
1138425542_1138425546 -1 Left 1138425542 16:56929772-56929794 CCTGCTTCACAGAGATGGGATGT No data
Right 1138425546 16:56929794-56929816 TTGCAATAGGCCAGGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138425546 Original CRISPR TTGCAATAGGCCAGGCATGG AGG Intergenic