ID: 1138426718

View in Genome Browser
Species Human (GRCh38)
Location 16:56939065-56939087
Sequence CCTTCTGTGCTTGTGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138426715_1138426718 20 Left 1138426715 16:56939022-56939044 CCTGTGGGATGGGACTGTGGTAG 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1138426718 16:56939065-56939087 CCTTCTGTGCTTGTGGTACATGG 0: 1
1: 0
2: 2
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138426718 Original CRISPR CCTTCTGTGCTTGTGGTACA TGG Intronic
900549298 1:3246147-3246169 CCTTCTGTGCCTCTGGGCCACGG + Intronic
901489039 1:9587098-9587120 CCTTATGTGCTTGTGGGAAGTGG - Intergenic
908036199 1:60056475-60056497 CATTCTTTGCTTGTGATAAAGGG + Intronic
910478458 1:87633790-87633812 CCCTGTGGGCATGTGGTACAGGG + Intergenic
911315944 1:96356992-96357014 CTTTCTGTGCCTCTGCTACAAGG - Intergenic
911436607 1:97867737-97867759 CGTTGTGAGCTTGTGATACATGG - Intronic
920275379 1:204800581-204800603 CCTTCTGGTTTTGTGGTACTGGG + Intergenic
922969977 1:229728021-229728043 CCTGCTGTCCTTGTGGGGCAAGG - Intergenic
923038097 1:230299702-230299724 CCTTTTGTGTTTCTGGTTCAAGG - Intergenic
1065696362 10:28384207-28384229 CCTTCTGTTATTTAGGTACATGG + Intergenic
1068227951 10:54131022-54131044 CCCTTTGTGCTTCTGGTAGAAGG - Intronic
1076352158 10:129824540-129824562 GCTTCTGTGCTCGAGGCACATGG - Intergenic
1079961384 11:26928309-26928331 CCTTCTGTGCCTCTGGTAGAAGG - Intergenic
1082727433 11:56752838-56752860 CCTTCTTTGATTGTGGTAGGTGG - Intergenic
1083516623 11:63264931-63264953 CCTTCTCTTCTAGTGGTACCTGG - Intronic
1088086239 11:105983985-105984007 CCTTCTAGGCTTGTGGTACATGG - Intergenic
1089362854 11:117902483-117902505 CCTTCTCTGCCTGGGGAACAGGG - Intronic
1091933417 12:4415473-4415495 CCTTCTGTGCTCGTCGTCCATGG - Intergenic
1091945095 12:4532489-4532511 CTATCTGGGCTGGTGGTACAGGG - Intronic
1102785844 12:115604253-115604275 GCTTCTGTGATTGTGTTAAAGGG - Intergenic
1103917845 12:124385182-124385204 CCTTCTGTGCTTGTGGAGGAGGG + Intronic
1104450255 12:128863290-128863312 CCTTCTTTCCTTCTGGTACAAGG + Intronic
1109074378 13:57815619-57815641 CCTTGTGTGTTTGAGGAACAGGG + Intergenic
1111002609 13:82205340-82205362 CCCTCTGTGCTCTTGGAACAAGG + Intergenic
1111424309 13:88059167-88059189 CCGTCTGTGGTGGTGGTGCAGGG - Intergenic
1112718929 13:102219487-102219509 CCTTCTGAGCTTGTGGAAATTGG + Intronic
1112880030 13:104095717-104095739 CCCTCTGTGCCTGTGGAAGATGG - Intergenic
1113282528 13:108804850-108804872 CCAGCTGTGCTTGTGGTAAGTGG + Intronic
1113321413 13:109235891-109235913 CAGTCTGGGCTTGTAGTACAGGG + Intergenic
1113945381 13:114041093-114041115 TCTTCTCTGCTTGTGTTGCAGGG - Exonic
1115418453 14:33164874-33164896 CCTTCTGTACTGGTGAGACAGGG + Intronic
1120410449 14:84147228-84147250 CCTTTTGTGATTGCGGTAAAGGG + Intergenic
1121909286 14:97774554-97774576 CCTTCTGTGAGTGTGGAAAAGGG - Intergenic
1123697265 15:22887886-22887908 CCTTCTCTGCTTGTCGAACAAGG - Intronic
1126870123 15:52978504-52978526 CCTTCTTTGCATGTGGAACCTGG + Intergenic
1131052072 15:89355064-89355086 ACTGCTGTGGTTGTGGTCCAGGG + Intergenic
1138041674 16:53677752-53677774 ACCTCTGTGCTTGTGGAGCAAGG + Intronic
1138426718 16:56939065-56939087 CCTTCTGTGCTTGTGGTACATGG + Intronic
1138659656 16:58509639-58509661 CCTTCCGTGCTGGGGGTCCAGGG + Intronic
1141431442 16:83972211-83972233 CCTTCTGTCCTCGTGCTTCATGG + Intronic
1141808225 16:86356265-86356287 CATTCTGTCCTTGTGGTGCTGGG + Intergenic
1142802077 17:2352554-2352576 CCTAGTTTGCTTGAGGTACAGGG - Intronic
1143465654 17:7134476-7134498 ATTTCTGTGCTTCTGGCACAGGG - Intergenic
1146232901 17:31130112-31130134 CCTTGGATGTTTGTGGTACAAGG + Intronic
1147448037 17:40487035-40487057 CCCTCTGGGCATGTGGTAAAGGG + Exonic
1150535992 17:66041656-66041678 ACTTCTGTGCTTCTTGGACATGG - Intronic
1158324605 18:56300588-56300610 CTTTCTGCTCTTGTGATACAAGG + Intergenic
1158823084 18:61183731-61183753 CCTTGTGTGCTTCTAGTCCAAGG + Intergenic
1159753769 18:72337216-72337238 CATACTGTGCTTGTGGGAGATGG + Intergenic
1160865249 19:1253295-1253317 CCTTCTCTGCTTGGGGCCCATGG - Intronic
1162657513 19:12142428-12142450 CCTTTTCTGCTTTTGGAACAAGG + Intronic
1164325603 19:24188617-24188639 CCTTCTGTGGGTCTGGCACAGGG + Intergenic
1165012059 19:32855945-32855967 CTATCTGGGCTGGTGGTACAGGG - Intronic
1166325864 19:42050856-42050878 TCTCCTGAGCTTGTGGTTCATGG - Intronic
1166652296 19:44583738-44583760 CCTGCTGAGCTTGGGGGACAAGG + Intergenic
1167234117 19:48303531-48303553 CCATCTGTGCTGGAGGAACAAGG - Intronic
1167918304 19:52760514-52760536 CTTTGTGTGATTGTGTTACAGGG - Intergenic
926220357 2:10932069-10932091 CCTTCTGTGCATGTGGCTCTTGG + Intergenic
928396515 2:30946748-30946770 CATTCTATGCCTGTGGTTCATGG + Intronic
928637427 2:33262068-33262090 GCTTCTTTGCTTGAGGTCCAGGG + Intronic
928805070 2:35140615-35140637 GCTTCTGTGCTGGTGGACCATGG - Intergenic
931703347 2:64926495-64926517 GCCTCTGGGCTTGTGATACAAGG - Intergenic
935113543 2:100113828-100113850 CCTTCTCTGCTAGGGGAACATGG - Intronic
937477599 2:122229152-122229174 CTTCCTGTGCTTGTGGTCCTGGG + Intergenic
937745397 2:125406336-125406358 CCTTCTGTGCTTTTGTCAGAAGG - Intergenic
938744825 2:134267517-134267539 CCTTCTGTGACTGTGTGACATGG - Intronic
940469200 2:154072255-154072277 CCTTCTGGACTAGTGCTACATGG + Intronic
940797452 2:158095509-158095531 TCTACTCTGCTTCTGGTACATGG - Intronic
941788796 2:169527861-169527883 CATTATATACTTGTGGTACATGG - Intergenic
942226215 2:173818644-173818666 AGTTCTGTCCTTGTGGTAAAGGG + Intergenic
943753899 2:191538430-191538452 CCTACTGTGGATGAGGTACAGGG - Intergenic
944452950 2:199861643-199861665 CCTTCTTTGCTGATTGTACATGG - Intergenic
945012547 2:205480728-205480750 CCTTCTGTTCTTGTGGTGGAAGG + Intronic
945520769 2:210824463-210824485 CCTTCTTTATTTGTGGTAAAAGG + Intergenic
945890878 2:215429523-215429545 ACTTCTATTCTTGTGGTAGATGG - Intronic
1173265631 20:41477479-41477501 CCTTCTGTAATTTTGGTAAATGG - Intronic
1175428034 20:58882432-58882454 TCTTCCGTGCTTGTGGCAAAAGG + Intronic
1176520796 21:7822580-7822602 CCTTCTGAGACTGTGGTTCAGGG - Intronic
1176980994 21:15380874-15380896 CCTTGTGTGCTTCTGGAACCTGG - Intergenic
1178654820 21:34452592-34452614 CCTTCTGAGACTGTGGTTCAGGG - Intergenic
1180588533 22:16915399-16915421 CCGTCTGTGCTTGTGGGAATGGG - Intergenic
949394951 3:3604674-3604696 CCTCCTCTGCTTTTGGTCCAAGG + Intergenic
951421100 3:22486019-22486041 CATTCTGTGCTACTTGTACAGGG + Intergenic
951966635 3:28393454-28393476 CCTTGTCTGATTGTGGTATAAGG - Intronic
954247797 3:49345431-49345453 TCTTCTGTTCTTGTGGCCCAAGG - Intergenic
957530449 3:81434241-81434263 CCTTCTTTGCTTTTGCTTCATGG - Intergenic
960067376 3:113387950-113387972 ACTTCTCTGCTTGTGGAAAAGGG + Intronic
962248578 3:133820113-133820135 TCTTCTGTGCTTTTGGTCCCTGG + Exonic
965441400 3:168719637-168719659 CCTTCAGTGCTTTTGGAAAAAGG - Intergenic
965912594 3:173797823-173797845 ACTTCTTTGCATGTGGCACATGG - Intronic
967517558 3:190388233-190388255 TCTTCTGTGTTTCTGGTACCTGG - Exonic
968411940 4:396890-396912 ACTTCTGTGTTTGTGTGACATGG + Intergenic
970640086 4:18054389-18054411 CTTTCTGTGCTTGTAGAACTAGG + Intergenic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
976146577 4:82047139-82047161 ACTTCTGTGATTATAGTACATGG - Intergenic
977756968 4:100682913-100682935 CCCTCTGTCCTTGTGATAAAAGG + Intronic
979692918 4:123579542-123579564 CTTTATATGCTTGTGATACAAGG + Intergenic
984763975 4:183385392-183385414 CCTGCTGTGCTTCTGTTCCAGGG + Intergenic
988615611 5:32771755-32771777 CATTCTGTTCTTATTGTACAAGG - Intronic
993099588 5:83521025-83521047 CCTTCAGTGCTTGTGATAGGTGG - Exonic
993836005 5:92821264-92821286 GCTTCTGTGATTTTAGTACATGG - Intergenic
995257568 5:110064793-110064815 CCTTATGTGTTTTTGGTACATGG + Intergenic
996327493 5:122291927-122291949 CCTTCTGTACATGCTGTACAAGG - Intergenic
996424024 5:123293229-123293251 CCCTCTCTGCTTGTGGTAGATGG - Intergenic
997943790 5:138181638-138181660 CCTTGGGTGCTTGTAGAACAAGG - Exonic
998411237 5:141913161-141913183 CCTTCTCTGCATGTACTACATGG - Intergenic
998781921 5:145666778-145666800 CCTTCTGTGCTTGTCAAACAAGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1004129675 6:12907608-12907630 CCTTCTGTGAATTTGGTACCAGG - Intronic
1005064871 6:21808152-21808174 GCTTCTGTCCTTGTGCTCCATGG + Intergenic
1008672339 6:53783433-53783455 CCTTGTCTGCTTTTGGTACCAGG - Intergenic
1010012478 6:71064922-71064944 CCTTCTGTGGTTTTGGTATTAGG + Intergenic
1010023602 6:71190001-71190023 CCTTCTGTGCTTCTGGTGGGTGG - Intergenic
1011560370 6:88607916-88607938 CATTCTGTCCTTGTGATATAAGG - Intergenic
1013767235 6:113589306-113589328 CTTTCTCTGCTTTTGCTACATGG - Intergenic
1016787219 6:148024233-148024255 CCTTTTGTGCTTTTTGTACCTGG + Intergenic
1017516706 6:155162636-155162658 CCTTCTGGGATTCTGGTGCATGG - Intronic
1023521066 7:41050369-41050391 CCATCTGTCCTTGGTGTACATGG + Intergenic
1027516018 7:79142830-79142852 GCTTCTCTGCTGGTGGAACAGGG - Intronic
1028900252 7:96091034-96091056 CCATCTGTGTGTGTGGTAAAGGG + Intronic
1030070223 7:105691934-105691956 CTTTCTGTGCTTGTTGTTCTTGG - Intronic
1031068937 7:117140901-117140923 CCTCCTCTGTTTGTGGTGCAAGG - Intronic
1032443332 7:131959173-131959195 CCTTCTGGGCTTCAGGCACAGGG - Intergenic
1035837704 8:2772302-2772324 CTTTTTGTGTTTGTTGTACAGGG - Intergenic
1038242635 8:25824031-25824053 CCAGCTGTGCTTGTGCTATAGGG + Intergenic
1039403743 8:37295037-37295059 CCTTCTGTGCTTATCGGATAAGG + Intergenic
1041746899 8:61217270-61217292 CATTCTCTTCTTGTGGTTCATGG - Intronic
1044350635 8:91161272-91161294 CCTTTTGTGGTTTTGGTATAAGG + Intronic
1051880078 9:21831036-21831058 CCTCCTGTACTTGTGGTACATGG + Intronic
1059649171 9:116299034-116299056 TCTTCTGTGCTTGGGGCAGAGGG + Intronic
1060048340 9:120358748-120358770 CCTACAGTGTTGGTGGTACAGGG - Intergenic
1060235073 9:121857057-121857079 CCTTCTGTGCCTGTGGTCTCAGG - Intronic
1061370001 9:130192763-130192785 CCTTGTGTGCTTGGGGCACCTGG + Intronic
1062600814 9:137317908-137317930 CCCTCTGTGCCTGTGTGACATGG + Intronic
1190549676 X:51566162-51566184 CATTCTGTGCTTTTTTTACAGGG - Intergenic
1196145179 X:112308641-112308663 CTCTCTGTACTTTTGGTACATGG + Intergenic
1198253931 X:134908615-134908637 TTTTCTGTGCCTTTGGTACAGGG - Intronic
1198881188 X:141282952-141282974 TCTTCTCTGCTTATTGTACAAGG - Intergenic
1199714860 X:150500273-150500295 CCCTCTGTGCTTGTGCTCCTTGG - Intronic
1201011598 Y:9552304-9552326 TCTCCTGTGTTTGTGGGACATGG - Intergenic