ID: 1138427453

View in Genome Browser
Species Human (GRCh38)
Location 16:56945558-56945580
Sequence TGCTTGCCCCAGTGGGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138427453_1138427463 17 Left 1138427453 16:56945558-56945580 CCCCATCCCCACTGGGGCAAGCA No data
Right 1138427463 16:56945598-56945620 GGCCTAAGACGGCTGACAGGTGG No data
1138427453_1138427466 24 Left 1138427453 16:56945558-56945580 CCCCATCCCCACTGGGGCAAGCA No data
Right 1138427466 16:56945605-56945627 GACGGCTGACAGGTGGGACATGG No data
1138427453_1138427464 18 Left 1138427453 16:56945558-56945580 CCCCATCCCCACTGGGGCAAGCA No data
Right 1138427464 16:56945599-56945621 GCCTAAGACGGCTGACAGGTGGG No data
1138427453_1138427461 6 Left 1138427453 16:56945558-56945580 CCCCATCCCCACTGGGGCAAGCA No data
Right 1138427461 16:56945587-56945609 TTAGCAATTAAGGCCTAAGACGG No data
1138427453_1138427460 -4 Left 1138427453 16:56945558-56945580 CCCCATCCCCACTGGGGCAAGCA No data
Right 1138427460 16:56945577-56945599 AGCAGGACTCTTAGCAATTAAGG No data
1138427453_1138427462 14 Left 1138427453 16:56945558-56945580 CCCCATCCCCACTGGGGCAAGCA No data
Right 1138427462 16:56945595-56945617 TAAGGCCTAAGACGGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138427453 Original CRISPR TGCTTGCCCCAGTGGGGATG GGG (reversed) Intergenic
No off target data available for this crispr