ID: 1138427521

View in Genome Browser
Species Human (GRCh38)
Location 16:56945970-56945992
Sequence CCCAGCTTCAGGCATATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138427521_1138427532 27 Left 1138427521 16:56945970-56945992 CCTTTAATATGCCTGAAGCTGGG No data
Right 1138427532 16:56946020-56946042 ACTATCCATGTGCCTCATTTTGG No data
1138427521_1138427533 28 Left 1138427521 16:56945970-56945992 CCTTTAATATGCCTGAAGCTGGG No data
Right 1138427533 16:56946021-56946043 CTATCCATGTGCCTCATTTTGGG No data
1138427521_1138427526 4 Left 1138427521 16:56945970-56945992 CCTTTAATATGCCTGAAGCTGGG No data
Right 1138427526 16:56945997-56946019 TCCCTTCCTGAGAATGGCCCAGG No data
1138427521_1138427525 -2 Left 1138427521 16:56945970-56945992 CCTTTAATATGCCTGAAGCTGGG No data
Right 1138427525 16:56945991-56946013 GGGCTTTCCCTTCCTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138427521 Original CRISPR CCCAGCTTCAGGCATATTAA AGG (reversed) Intergenic