ID: 1138427525 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:56945991-56946013 |
Sequence | GGGCTTTCCCTTCCTGAGAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1138427521_1138427525 | -2 | Left | 1138427521 | 16:56945970-56945992 | CCTTTAATATGCCTGAAGCTGGG | No data | ||
Right | 1138427525 | 16:56945991-56946013 | GGGCTTTCCCTTCCTGAGAATGG | No data | ||||
1138427519_1138427525 | 8 | Left | 1138427519 | 16:56945960-56945982 | CCTTCTGGGTCCTTTAATATGCC | No data | ||
Right | 1138427525 | 16:56945991-56946013 | GGGCTTTCCCTTCCTGAGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1138427525 | Original CRISPR | GGGCTTTCCCTTCCTGAGAA TGG | Intergenic | ||