ID: 1138427526

View in Genome Browser
Species Human (GRCh38)
Location 16:56945997-56946019
Sequence TCCCTTCCTGAGAATGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138427521_1138427526 4 Left 1138427521 16:56945970-56945992 CCTTTAATATGCCTGAAGCTGGG No data
Right 1138427526 16:56945997-56946019 TCCCTTCCTGAGAATGGCCCAGG No data
1138427524_1138427526 -7 Left 1138427524 16:56945981-56946003 CCTGAAGCTGGGGCTTTCCCTTC No data
Right 1138427526 16:56945997-56946019 TCCCTTCCTGAGAATGGCCCAGG No data
1138427519_1138427526 14 Left 1138427519 16:56945960-56945982 CCTTCTGGGTCCTTTAATATGCC No data
Right 1138427526 16:56945997-56946019 TCCCTTCCTGAGAATGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138427526 Original CRISPR TCCCTTCCTGAGAATGGCCC AGG Intergenic