ID: 1138427529

View in Genome Browser
Species Human (GRCh38)
Location 16:56946003-56946025
Sequence GATAGTCCTGGGCCATTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138427529_1138427532 -6 Left 1138427529 16:56946003-56946025 CCTGAGAATGGCCCAGGACTATC No data
Right 1138427532 16:56946020-56946042 ACTATCCATGTGCCTCATTTTGG No data
1138427529_1138427533 -5 Left 1138427529 16:56946003-56946025 CCTGAGAATGGCCCAGGACTATC No data
Right 1138427533 16:56946021-56946043 CTATCCATGTGCCTCATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138427529 Original CRISPR GATAGTCCTGGGCCATTCTC AGG (reversed) Intergenic