ID: 1138427533

View in Genome Browser
Species Human (GRCh38)
Location 16:56946021-56946043
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138427528_1138427533 -1 Left 1138427528 16:56945999-56946021 CCTTCCTGAGAATGGCCCAGGAC No data
Right 1138427533 16:56946021-56946043 CTATCCATGTGCCTCATTTTGGG No data
1138427529_1138427533 -5 Left 1138427529 16:56946003-56946025 CCTGAGAATGGCCCAGGACTATC No data
Right 1138427533 16:56946021-56946043 CTATCCATGTGCCTCATTTTGGG No data
1138427524_1138427533 17 Left 1138427524 16:56945981-56946003 CCTGAAGCTGGGGCTTTCCCTTC No data
Right 1138427533 16:56946021-56946043 CTATCCATGTGCCTCATTTTGGG No data
1138427521_1138427533 28 Left 1138427521 16:56945970-56945992 CCTTTAATATGCCTGAAGCTGGG No data
Right 1138427533 16:56946021-56946043 CTATCCATGTGCCTCATTTTGGG No data
1138427527_1138427533 0 Left 1138427527 16:56945998-56946020 CCCTTCCTGAGAATGGCCCAGGA No data
Right 1138427533 16:56946021-56946043 CTATCCATGTGCCTCATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138427533 Original CRISPR CTATCCATGTGCCTCATTTT GGG Intergenic