ID: 1138431728

View in Genome Browser
Species Human (GRCh38)
Location 16:56973182-56973204
Sequence TGTACCCAGTTTCCCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138431728_1138431736 22 Left 1138431728 16:56973182-56973204 CCCGCTGGGGGAAACTGGGTACA 0: 1
1: 0
2: 1
3: 26
4: 187
Right 1138431736 16:56973227-56973249 CTGCACTCTGGGCTGAATGCTGG 0: 1
1: 0
2: 1
3: 31
4: 268
1138431728_1138431731 10 Left 1138431728 16:56973182-56973204 CCCGCTGGGGGAAACTGGGTACA 0: 1
1: 0
2: 1
3: 26
4: 187
Right 1138431731 16:56973215-56973237 CAGTTTCCCCATCTGCACTCTGG 0: 1
1: 3
2: 24
3: 206
4: 1447
1138431728_1138431738 24 Left 1138431728 16:56973182-56973204 CCCGCTGGGGGAAACTGGGTACA 0: 1
1: 0
2: 1
3: 26
4: 187
Right 1138431738 16:56973229-56973251 GCACTCTGGGCTGAATGCTGGGG 0: 1
1: 0
2: 3
3: 19
4: 373
1138431728_1138431737 23 Left 1138431728 16:56973182-56973204 CCCGCTGGGGGAAACTGGGTACA 0: 1
1: 0
2: 1
3: 26
4: 187
Right 1138431737 16:56973228-56973250 TGCACTCTGGGCTGAATGCTGGG 0: 1
1: 0
2: 2
3: 19
4: 194
1138431728_1138431732 11 Left 1138431728 16:56973182-56973204 CCCGCTGGGGGAAACTGGGTACA 0: 1
1: 0
2: 1
3: 26
4: 187
Right 1138431732 16:56973216-56973238 AGTTTCCCCATCTGCACTCTGGG 0: 1
1: 2
2: 15
3: 138
4: 1121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138431728 Original CRISPR TGTACCCAGTTTCCCCCAGC GGG (reversed) Intronic
901192980 1:7423524-7423546 TGTACCCAGCCTCCCCCCGCCGG + Intronic
901435487 1:9245021-9245043 GGTCCCCAGTTGCTCCCAGCAGG - Exonic
902900678 1:19513656-19513678 TGTGGCCAGTTTCCCACAGCGGG + Intergenic
904270136 1:29344433-29344455 TGGACCCAGTTTCCAGCAGGAGG + Intergenic
904428398 1:30446411-30446433 TGGACCCAGTTTCCAGCAGGAGG - Intergenic
905539276 1:38747167-38747189 TGAGCCCATTTTCCCCCAGCTGG + Intergenic
907914957 1:58860311-58860333 TCTACCCACTTTCCCCCTGTTGG + Intergenic
908275563 1:62467187-62467209 TGGACACAGTTTTCTCCAGCAGG - Intronic
909107941 1:71436133-71436155 TGGACACTGTTTCCTCCAGCAGG - Intronic
911395525 1:97303031-97303053 TGTGCCCAGTTTTCTACAGCAGG + Intronic
911789877 1:102000996-102001018 TGGACACAGTTTTCTCCAGCAGG + Intergenic
912841167 1:113040774-113040796 TGGACACAGTTTTCTCCAGCAGG - Intergenic
914829199 1:151158429-151158451 TGTGCCCACATTCCTCCAGCCGG + Intronic
915783978 1:158587265-158587287 TGTGTCCAGTTTCCATCAGCTGG - Intergenic
917500122 1:175578221-175578243 TGCATCCAGTTTCCCCCGGCAGG - Intronic
918384341 1:183990452-183990474 TGCACCCAGTTTCTCACAGATGG + Intronic
919331203 1:196174365-196174387 TGAACACAGTTTACTCCAGCAGG - Intergenic
920118178 1:203636038-203636060 AGTCCCCAGGTTCCCTCAGCTGG - Intronic
920244201 1:204575801-204575823 TGTACCCGGTGGCCCCCTGCCGG - Intergenic
921177410 1:212607173-212607195 AGTCCCCAGTTCCCCCCACCGGG - Intronic
921458260 1:215397562-215397584 TGGACACAGTTTTCTCCAGCAGG + Intergenic
1063184011 10:3634120-3634142 TGCACCCACGTTCCACCAGCTGG - Intergenic
1068670768 10:59720758-59720780 TCTCCCCATTTTCCCTCAGCAGG - Intronic
1069733232 10:70632834-70632856 TGGACACAGTTTTCTCCAGCAGG - Intergenic
1070789875 10:79182597-79182619 CTTACCCACTTTCCCCCAGAGGG - Intronic
1072768302 10:98114545-98114567 TGAGCCCAGTTGCCCACAGCAGG - Intergenic
1075241141 10:120780166-120780188 TTGATCCAGGTTCCCCCAGCAGG - Intergenic
1075348078 10:121699006-121699028 CGTACCCTGGGTCCCCCAGCTGG - Intergenic
1076280159 10:129239883-129239905 TGTGGCCTGTTTGCCCCAGCAGG - Intergenic
1076849675 10:133086754-133086776 TGGACCCTGTGTCCCTCAGCTGG + Intronic
1078430818 11:11287081-11287103 TGTTCCTAATTTCCCCCTGCTGG + Intronic
1080047817 11:27827545-27827567 CTTACCCAGTTTCCCTCAGCTGG + Intergenic
1082627682 11:55503748-55503770 TGTAACCAGCTTCACACAGCAGG - Intergenic
1083037926 11:59657529-59657551 TGTACCCAGCTTCACCCAACAGG - Exonic
1083868014 11:65468845-65468867 TTTACCCAGTTTCCTCCAATGGG - Intergenic
1084490895 11:69477721-69477743 TGAGCCCAGTTTCGCCCTGCAGG - Intergenic
1084643763 11:70442299-70442321 TTTACCCACTTTCCCACAGATGG - Intergenic
1084689185 11:70715265-70715287 TGTGCCCAGGGTCACCCAGCCGG + Intronic
1085461304 11:76695526-76695548 TGTACCCAGTGAGCTCCAGCAGG + Intergenic
1088060939 11:105648967-105648989 TGGACCCAGATGGCCCCAGCTGG - Intronic
1095573162 12:43705424-43705446 TGGACCCAGTTTCTAACAGCTGG - Intergenic
1095699623 12:45177442-45177464 TGTATCCATTTTCCTCCAGGTGG - Intergenic
1096111763 12:49033184-49033206 GGTGCTCAGTTCCCCCCAGCTGG - Exonic
1096244909 12:49979145-49979167 TGAAGCCTGCTTCCCCCAGCTGG - Intronic
1096687020 12:53294906-53294928 TATAACCATCTTCCCCCAGCCGG - Intergenic
1100675240 12:96859315-96859337 TTTACCCAGTTTCACATAGCTGG + Intronic
1101052387 12:100876413-100876435 TGGCCACAGTTTCCCCCTGCAGG + Intronic
1102561650 12:113766561-113766583 CGTACCCCGCTTCCTCCAGCAGG - Intergenic
1102601994 12:114038123-114038145 TGGCCTCAGTTTCCCCCATCTGG - Intergenic
1104042736 12:125141114-125141136 TTTACCCAGCATCCCCCAGATGG + Intronic
1105642618 13:22280999-22281021 TGAACCCAGTTGTCCCCAGATGG - Intergenic
1112240624 13:97678129-97678151 TTCACCCAACTTCCCCCAGCTGG - Intergenic
1112361400 13:98721964-98721986 TTTCCCCAGTTTCCCTCAGTGGG + Intronic
1112708083 13:102095114-102095136 TGGACACAGTTTCCTCCGGCAGG - Intronic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1114408584 14:22479285-22479307 TGTTCCCATTTTACCACAGCCGG + Intergenic
1114578077 14:23731253-23731275 TGTCCCCACTCTCCCCCAGTTGG + Intergenic
1116625704 14:47260165-47260187 TGTACCCATTTTCTCCAGGCAGG - Intronic
1116774923 14:49168011-49168033 GATTCCCAGTTTCCACCAGCAGG - Intergenic
1117365346 14:55021825-55021847 TGGACACAGTTTTCTCCAGCAGG + Intronic
1118213497 14:63787610-63787632 TGTAGCCAGGTTGTCCCAGCAGG + Intergenic
1119757453 14:77129011-77129033 TGTACCCAGTGTCCTCCAACTGG - Intronic
1121004349 14:90479077-90479099 TGAACACAGTTTTCTCCAGCAGG + Intergenic
1123927253 15:25128580-25128602 TGGACACAGTTTCCTCCAGCAGG + Intergenic
1125211373 15:37219281-37219303 TGTAACAAGTCTCCTCCAGCAGG - Intergenic
1125519655 15:40340716-40340738 TGTCCCCAGCTGCCCCCAGAGGG + Intronic
1126064131 15:44812160-44812182 TGTACCCAATTTACCACAACTGG + Intergenic
1127421676 15:58812481-58812503 TTTACCCAGTTTTCCCCAATGGG + Intronic
1128232741 15:66046932-66046954 GGTCCCCAGGTTCCCCCTGCAGG + Intronic
1129269877 15:74413979-74414001 TCCACCCAGCTTCCCCCAGCAGG + Intronic
1131048954 15:89334072-89334094 TGGACCCCGGTTCCCCCAGGAGG - Intronic
1131114346 15:89784817-89784839 TGCACCCAGCTTCCCCCACCCGG + Intergenic
1131927007 15:97395808-97395830 AGTAACCAGTTTTCTCCAGCAGG + Intergenic
1132269602 15:100512219-100512241 TGGATCCATTTTCCCCAAGCAGG - Intronic
1135673231 16:24392516-24392538 CGTCCTCAGTTTCCCCCACCTGG + Intergenic
1138431728 16:56973182-56973204 TGTACCCAGTTTCCCCCAGCGGG - Intronic
1143803485 17:9405068-9405090 TGGACACAGTTTTCTCCAGCAGG + Intronic
1146057465 17:29588663-29588685 TGTTCCCAGTCACCACCAGCAGG + Intronic
1147214196 17:38890037-38890059 TGTGCCCATCTTCCCCCAGCCGG + Intronic
1148705842 17:49631387-49631409 TGTACCCAGTTTCCTCCCATGGG - Intronic
1151936209 17:77263250-77263272 TGTGCTCAGTTGCCCTCAGCTGG - Intergenic
1152023941 17:77796738-77796760 TGTCCCCAGCTGCCCCCAGCAGG - Intergenic
1152199656 17:78938015-78938037 TGTCCCCCTTTTCCACCAGCAGG + Intergenic
1152516823 17:80830149-80830171 TGTACACAGATTCTCCCCGCTGG + Intronic
1157385242 18:47254662-47254684 TGGGCCCAGTTTCCTCCACCTGG + Intergenic
1158288166 18:55908139-55908161 TGTTCCAAGTTTGCCCCAGGTGG - Intergenic
1158912124 18:62075150-62075172 TTTACCCAGTTTCCCCCAGTGGG + Intronic
1159080172 18:63727317-63727339 TGTGCCCAGCTGCCACCAGCTGG - Intergenic
1160348414 18:78153461-78153483 TGGACCCCGTCTCCCCCAGTGGG - Intergenic
1160508744 18:79441594-79441616 TCTCCCCAGTCTACCCCAGCAGG - Intronic
1161647367 19:5461840-5461862 TGTTCCCCGTTTCTCCCAGGAGG + Intergenic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1162764169 19:12908189-12908211 TCCACCCGGTCTCCCCCAGCCGG + Intronic
1166658602 19:44630185-44630207 TGGCCCCAGTTCCTCCCAGCTGG - Intronic
1166858532 19:45795837-45795859 TCTAGCCACTTTCCCCAAGCAGG - Exonic
926626447 2:15094688-15094710 TGTGCCCAGCTTCCCTCAGCCGG + Intergenic
927803532 2:26123473-26123495 GGTACACAGTTTTCTCCAGCAGG - Intronic
928281889 2:29953905-29953927 GGTAGCCATTTTCCCCCATCTGG - Intergenic
935713658 2:105920535-105920557 AATTCCCAGGTTCCCCCAGCAGG + Intergenic
936979997 2:118255512-118255534 TCTTCCCAGGTTCCCACAGCCGG + Intergenic
937224830 2:120362584-120362606 TGAACACAGTGTCCCTCAGCAGG + Intergenic
937391312 2:121489414-121489436 TGTGCCCAATTCCCCACAGCAGG + Intronic
943701599 2:190993899-190993921 TGTCACCCTTTTCCCCCAGCAGG - Intronic
945491996 2:210466859-210466881 TGAACCCAGTTTTCTCCAGCAGG - Intronic
946290689 2:218742743-218742765 TCTACTCAGTTTCCCCCATTGGG + Intronic
947268773 2:228309293-228309315 TGGACCCAGTTTCCAACAGCTGG + Intergenic
947650547 2:231782509-231782531 TGTCCCCACTTTCACCCATCTGG + Intronic
948330341 2:237159713-237159735 TGTGCCCAGTTTCCACCAACTGG - Intergenic
948567931 2:238898181-238898203 TGTAACCAGCTGCCCCTAGCAGG + Intronic
1172314375 20:33942338-33942360 TGTAGCCAATGTCCCCCACCTGG - Intergenic
1174024174 20:47558913-47558935 TGGACACAGTTTTCTCCAGCAGG + Intronic
1174125738 20:48304307-48304329 TGTGGCCACTTTCCCCCAGTAGG + Intergenic
1175696117 20:61104256-61104278 TGTATCCATTTTCCCTGAGCTGG + Intergenic
1179432116 21:41328943-41328965 TGTGCCCAGTTTTCTCCAGCAGG + Intronic
1182063857 22:27416817-27416839 TGAATCCTGCTTCCCCCAGCTGG + Intergenic
1183049588 22:35250090-35250112 TTCACCCAGTTTCTCCCATCAGG + Intergenic
1183226254 22:36551893-36551915 TGTGCCCAGGTTCACACAGCAGG - Intergenic
1184661157 22:45966160-45966182 AGGACTCAGTTTCCCCCAGAAGG - Intronic
1184871816 22:47245506-47245528 CCTCCCCAGATTCCCCCAGCAGG + Intergenic
1185122036 22:48977137-48977159 TGTGCCCTGTTCCCTCCAGCAGG + Intergenic
950010660 3:9721284-9721306 TGCCCCCAGATTCCCCCAGAGGG - Intronic
950508491 3:13411265-13411287 TTTACCCAGTTTCCTTCAGCTGG - Intronic
950560091 3:13716156-13716178 AGAACCCAGGTTCCCACAGCAGG + Intergenic
951217909 3:20041206-20041228 TGCACCCAGTTCCTCCCAGTGGG - Intronic
952523302 3:34184066-34184088 TGTACCCAATTTACCACAACTGG - Intergenic
953495908 3:43386808-43386830 TGAACCCCCTTTCCCTCAGCAGG - Intronic
955637960 3:61050841-61050863 TCTGCCCAGTTTCTCCCAGCTGG - Intronic
957252401 3:77790304-77790326 TGTTTCCAGTTTCTCTCAGCAGG - Intergenic
958256631 3:91332559-91332581 TCTCCCCAGTTTCTCCCATCTGG + Intergenic
959468014 3:106714089-106714111 TGGACACAGTTTTCTCCAGCAGG + Intergenic
959916231 3:111819507-111819529 TGTACTCATTGTCCCCCAGGTGG - Intronic
960574696 3:119218258-119218280 AGTTCCCAGTGTCCCCCTGCAGG - Intronic
963015219 3:140817499-140817521 TTTACCGAGTTTCCCCCAATAGG - Intergenic
963031871 3:140986724-140986746 TGGACACAGTTTTCTCCAGCAGG - Intergenic
965061623 3:163791196-163791218 TGGACACAGTTTTCTCCAGCAGG + Intergenic
966349761 3:179019977-179019999 TGAATCCAGTTTTCCCAAGCTGG - Exonic
968025874 3:195442499-195442521 TGCACCCCATTTCCCCCAGCGGG + Intronic
969252645 4:5979682-5979704 TTTGCCCGGTTTCCCCCAGTGGG + Intronic
970000511 4:11360929-11360951 TGGACACAGTTTTCCCCAGCAGG - Intergenic
971732544 4:30404340-30404362 TGGACCCAGTTTTCTCTAGCAGG - Intergenic
974914047 4:68157399-68157421 TGGACCCAGTTTCTAACAGCTGG + Intergenic
974994959 4:69143986-69144008 TGTCCCCAATTTACCCCAGGTGG + Intronic
976285936 4:83371131-83371153 TGCACCCACTCTTCCCCAGCAGG - Intergenic
981170467 4:141616827-141616849 TGAACGCAGTTTTCTCCAGCAGG + Intergenic
982425478 4:155253685-155253707 TGGACCCAGTTTTCTCCAGCAGG + Intergenic
984074848 4:175163673-175163695 TGGACACAGTTTCCTCCAGCAGG + Intergenic
984444490 4:179818034-179818056 TGGACACAGTTTTCTCCAGCAGG + Intergenic
984862296 4:184251940-184251962 TGGACCCAGTTTCTAACAGCTGG + Intergenic
984926976 4:184815487-184815509 TCTTCCCAGTTTCCCCCCCCAGG - Intronic
984999460 4:185470053-185470075 TGTCCTCAGATTCCCCTAGCTGG + Intronic
986446469 5:7825632-7825654 TCCACCCAGTGTCCCCTAGCAGG - Intronic
987970598 5:24939056-24939078 TGTCCCCAGTTGCCCTCAGCTGG - Intergenic
989601956 5:43208646-43208668 CATACCCAGTTTCCCCTAACTGG - Intronic
989731906 5:44659077-44659099 TGGACACAGTTTTCTCCAGCAGG + Intergenic
993638602 5:90375324-90375346 TGGACACAGTTTTCTCCAGCAGG + Intergenic
996475210 5:123910716-123910738 TGAAGCCAGTTTCCCACAGGTGG - Intergenic
997165580 5:131657647-131657669 TGGACACAGTTTTCTCCAGCTGG - Intronic
999270677 5:150294803-150294825 TGGCCCAAGTTTCCTCCAGCCGG - Intergenic
1001400216 5:171441982-171442004 CAGACCCAGCTTCCCCCAGCAGG + Intronic
1002464648 5:179400857-179400879 TTTACCCAGTTTCTCCCATTTGG + Intergenic
1003309467 6:4957008-4957030 TGTAACCAACTTTCCCCAGCTGG + Intergenic
1003558618 6:7162788-7162810 TCTACTCAGTTTCCTGCAGCTGG - Intronic
1003765694 6:9233889-9233911 TGGACACAGTTTTCTCCAGCAGG - Intergenic
1007117752 6:39355861-39355883 TGTACCCAGCTTCCCCTATCGGG + Intronic
1007409905 6:41655567-41655589 TGTACCCTGTTTTTCCCACCTGG + Intergenic
1008077284 6:47158451-47158473 TTTGCCCAGTTTCTCCCAGTTGG - Intergenic
1008998707 6:57688601-57688623 TCTCCCCAGTTTCTCCCATCTGG - Intergenic
1009859095 6:69302802-69302824 TGGACACAGTTTTCTCCAGCAGG - Intronic
1010828590 6:80503015-80503037 TGGACACAGTTTTTCCCAGCAGG - Intergenic
1013834988 6:114323996-114324018 AGAAGCCAGTGTCCCCCAGCAGG - Intronic
1014747522 6:125217388-125217410 TGTCTCCCGTTTCCCCCAGATGG - Intronic
1015776551 6:136820709-136820731 TGTAAATAGTTTACCCCAGCTGG + Intergenic
1017473719 6:154766755-154766777 TGGACACAGTTTTGCCCAGCAGG + Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1021482777 7:21136163-21136185 TGGACACAGTTTTCTCCAGCAGG - Intergenic
1021818109 7:24467929-24467951 TTTACCCAGTTTCCCCCCAGTGG + Intergenic
1024979126 7:55142809-55142831 GGTACCAAGTTTCACTCAGCTGG + Intronic
1025623781 7:63199490-63199512 TGGACACAGTTTTCTCCAGCAGG + Intergenic
1031533190 7:122900940-122900962 TGTAACTATTTTCCCCAAGCTGG - Intergenic
1032570155 7:132987349-132987371 TGGACACAGTTTCCTCCAGGAGG - Intronic
1032887536 7:136157644-136157666 TTTGCCCAGTTTCCCCCAATTGG + Intergenic
1037733870 8:21551306-21551328 TCTACCCAGTTCACCCCAGGTGG + Intergenic
1038073696 8:24046437-24046459 TGTCCACAGTCTCCCACAGCCGG - Intergenic
1038756230 8:30343296-30343318 TTTGCCCAGTTTCCCCCAAGGGG + Intergenic
1040515716 8:48133183-48133205 TTCCCCCAGTTTCCCCCAGTGGG + Intergenic
1041254791 8:55970980-55971002 TTTTCCCAGCTTCCACCAGCAGG - Intronic
1041546670 8:59052687-59052709 TTTGCCCAGTGTCACCCAGCTGG - Intronic
1041592718 8:59608054-59608076 TGGACACAGTTTTCTCCAGCGGG - Intergenic
1043539974 8:81250635-81250657 GGTACACAGTTTTCTCCAGCAGG - Intergenic
1044013686 8:87025291-87025313 GGGACCCAGGTTGCCCCAGCTGG - Intronic
1044031749 8:87246952-87246974 TGTCTCCAGTTGCCCCCAGATGG - Intronic
1044171807 8:89062784-89062806 TGGACACAGTTTTCTCCAGCAGG + Intergenic
1047220835 8:122917022-122917044 TGTCCCCAGTCCCCCCCACCAGG + Intronic
1047632967 8:126728141-126728163 TGCACCCAGATTCCCTTAGCAGG - Intergenic
1048253218 8:132884396-132884418 TCTACCCAGCTTCCCCAAGTTGG - Intronic
1050722113 9:8601881-8601903 TGTACCTAGATTCCCCAATCTGG - Intronic
1053441282 9:38118305-38118327 TGCACCGACTTTTCCCCAGCTGG - Intergenic
1055573514 9:77640805-77640827 TGTACCAATTCTTCCCCAGCTGG - Intronic
1057186017 9:93058131-93058153 TCCATCCTGTTTCCCCCAGCCGG + Intergenic
1057536980 9:95919716-95919738 TGGACACAGTTTTCTCCAGCAGG - Intronic
1057848703 9:98547097-98547119 GGTACCCAGTTTCCTCTACCTGG + Intronic
1058831757 9:108823924-108823946 TGTACCCATTTAGCCACAGCTGG + Intergenic
1060239832 9:121893513-121893535 TTTGCCCAGTGTCCCACAGCAGG + Intronic
1062369986 9:136233578-136233600 TGGACACAGTTTTCTCCAGCGGG - Intronic
1062540025 9:137037471-137037493 TCAAGCCAGTCTCCCCCAGCAGG + Exonic
1186486126 X:9935759-9935781 TGTATCCAATTTTCCACAGCAGG - Intronic
1187121603 X:16412920-16412942 TGGACACAGTTTTTCCCAGCAGG - Intergenic
1189287947 X:39865486-39865508 TCTTGCCAGTTTCTCCCAGCAGG - Intergenic
1189350583 X:40272846-40272868 TCTACCCTGTTTCCCGCACCTGG + Intergenic
1193897122 X:87127791-87127813 TGTACTCAGTTGCCTACAGCTGG - Intergenic
1194236649 X:91392507-91392529 TGGACACAGTTTTCTCCAGCAGG - Intergenic
1195506570 X:105664884-105664906 TGGACACAGTTTTCTCCAGCAGG - Intronic
1198456033 X:136818807-136818829 TGGACACAGTTTTCTCCAGCAGG + Intergenic
1201277961 Y:12316000-12316022 TGTAACCAGCTTCACACAGCAGG - Intergenic
1201357850 Y:13115309-13115331 TGTAACCAGCTTCACCCAGCAGG - Intergenic