ID: 1138431808

View in Genome Browser
Species Human (GRCh38)
Location 16:56973564-56973586
Sequence GTGTGTGCACACGCATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 2, 1: 0, 2: 6, 3: 39, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138431804_1138431808 -1 Left 1138431804 16:56973542-56973564 CCAGATGGCATGTGGTATGTGTG 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1138431808 16:56973564-56973586 GTGTGTGCACACGCATGGGGAGG 0: 2
1: 0
2: 6
3: 39
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138431808 Original CRISPR GTGTGTGCACACGCATGGGG AGG Intronic
900053444 1:611282-611304 GTGTGTGTCTACGCATGTGGGGG + Intergenic
900480010 1:2893625-2893647 TTGTGTGCACATGCATGTGTGGG - Intergenic
901438660 1:9264446-9264468 GCAGGTGCACAGGCATGGGGTGG - Exonic
902111714 1:14084455-14084477 GTGTGTACACATACATGGGCAGG - Intergenic
902667637 1:17950822-17950844 GTGTGTGCTCACCCATGTGTGGG + Intergenic
903190113 1:21651715-21651737 GTGCGTGTGCACGCGTGGGGGGG - Intronic
904254985 1:29249204-29249226 ATGTGGACACATGCATGGGGAGG + Intronic
904590523 1:31612790-31612812 GCATGAGCACAGGCATGGGGTGG - Intergenic
905031214 1:34885609-34885631 GTGTGCGCGCACCCATGGCGGGG + Exonic
905107568 1:35573571-35573593 AGGTGTGCACCAGCATGGGGCGG - Exonic
905174382 1:36126714-36126736 GTGTGTGTGCGCGCATGGGTGGG + Intergenic
906295156 1:44645086-44645108 GTGTGGGCACAGGCTTGGGCGGG + Intronic
906677694 1:47705217-47705239 GTGTGTATACAAGCATGGGAAGG + Intergenic
907299217 1:53476115-53476137 GTGTGTGCAAATGCAGCGGGAGG - Intergenic
907326324 1:53640812-53640834 GTGTGTGCACATGCATGAAAGGG - Intronic
911621501 1:100070969-100070991 GTATGTGCAGAGGCTTGGGGAGG - Intronic
915549912 1:156625778-156625800 GTGTGTGCACGCTCATGTCGGGG + Intergenic
915939923 1:160112548-160112570 GTGTGTGCACAGGGAGGGGGTGG - Intergenic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
920312232 1:205055319-205055341 GTGTAAGCACACACACGGGGAGG + Intronic
922023165 1:221724721-221724743 GTGTGTGCATGCACATGGAGGGG + Intronic
922746384 1:228046556-228046578 GTGTGTGCATGTGCATGGGGTGG + Intronic
922779271 1:228238520-228238542 GTGTGTGCACATGTATGTGTAGG - Intronic
922962061 1:229656015-229656037 GTGTGTGCACTCACATGGCCAGG - Intronic
924179387 1:241424895-241424917 GTGTGTGCACACACCTGGCCGGG - Intergenic
924463703 1:244282068-244282090 GTGTGTGCACACACAGAGTGAGG + Intergenic
1063755166 10:8999154-8999176 GTGTGTGGACACGGATGGGGAGG + Intergenic
1067159414 10:43810845-43810867 GTATGTGCTCACAAATGGGGAGG + Intergenic
1067222769 10:44355972-44355994 GTGTGTGTGCACGCTAGGGGTGG + Intergenic
1067552671 10:47246452-47246474 GTGTGTGCATGTGCATGGAGAGG - Intergenic
1069618392 10:69820778-69820800 GTGAGTGCAAATGCCTGGGGAGG - Intronic
1070813062 10:79307821-79307843 GTGTGTGTGTATGCATGGGGTGG - Intronic
1072661018 10:97363562-97363584 CTGTGTGCTCCTGCATGGGGTGG - Intronic
1073037294 10:100572960-100572982 GTGTGTGCACACGCATGGGGGGG + Intergenic
1073426816 10:103459921-103459943 ATGTGGGCACACACATGGGGAGG - Intergenic
1073457933 10:103648831-103648853 GGGTGTGCACACGCACGCGAGGG - Intronic
1075078506 10:119367743-119367765 GTGAGTGCACACGCCAGGGCTGG + Intronic
1075284857 10:121174669-121174691 GTATGTGCACACTCATGCGTGGG - Intergenic
1075416567 10:122268612-122268634 GTGTGTGCACAGCCATGCGTGGG + Intergenic
1076856656 10:133118840-133118862 GTGTGTGCACACTGAAGAGGTGG - Intronic
1076866014 10:133166733-133166755 GTTTGTGCATGTGCATGGGGGGG + Intronic
1076988932 11:259156-259178 GGGTGTGCACAGGGGTGGGGTGG - Intergenic
1077185227 11:1232771-1232793 GTGAGTGCCCACGCTGGGGGTGG + Intronic
1077253145 11:1569475-1569497 ATATGTGCACACGCGTGGGCTGG + Intronic
1077340392 11:2023844-2023866 GTGTGTGTACAGGTGTGGGGAGG + Intergenic
1077529243 11:3087545-3087567 GTGGGGGCACACGCAGGTGGAGG - Exonic
1078653110 11:13214236-13214258 GTGTGTGCACATGCTTGTGTTGG - Intergenic
1079076216 11:17386879-17386901 GTGTGTACACACGCGTGTGGGGG + Exonic
1079923989 11:26469328-26469350 GTGTGTGCAGGCGCATGTGAGGG + Intronic
1080170718 11:29298935-29298957 GTGTGTGCACAGGTATGTGGGGG + Intergenic
1082601822 11:55167753-55167775 GTGTGTTCTCACTCATAGGGGGG - Intergenic
1083708224 11:64531124-64531146 GTTTCTACACAAGCATGGGGCGG + Intergenic
1083857608 11:65400880-65400902 GTGCCTGCACACGGGTGGGGAGG + Intronic
1084754039 11:71223283-71223305 GGGTGTGCATTCTCATGGGGTGG + Intronic
1085109717 11:73876867-73876889 GAGCGTGCACACGGAAGGGGCGG + Exonic
1085126372 11:74005312-74005334 GTGTGTGGAGACGGAAGGGGAGG - Intronic
1085308408 11:75501323-75501345 GTGTTTGCACAAGTATGAGGTGG - Intronic
1085403881 11:76250291-76250313 GGGTGTGCACATGCTTGGGGTGG + Intergenic
1087534469 11:99425547-99425569 GAGTGTGCACACATTTGGGGTGG - Intronic
1088566747 11:111180604-111180626 GTGTGCGCGCACGCGTGTGGTGG - Intergenic
1088971222 11:114776129-114776151 GTGTCTGCAGAGGCCTGGGGAGG + Intergenic
1089132769 11:116225195-116225217 GTGTGTGCCCACACAGGGGATGG - Intergenic
1089565528 11:119369232-119369254 GTGCTTACACAAGCATGGGGAGG + Intronic
1089632064 11:119790014-119790036 GTGTGTGCACAGGCTGGGGTTGG + Intergenic
1202823377 11_KI270721v1_random:79033-79055 GTGTGTGTACAGGTGTGGGGAGG + Intergenic
1092196909 12:6555348-6555370 GTGGGTGCACCCGGATGGGGTGG - Exonic
1092255326 12:6923972-6923994 GTGTGTGCACGCGCATTTTGGGG + Intergenic
1092299743 12:7235551-7235573 GTGTGTGCACACGTGTGTGTTGG - Intergenic
1093525787 12:20102386-20102408 GGCTGTGCACACACTTGGGGTGG - Intergenic
1100813255 12:98361310-98361332 GTGTGTGTTCACACATGTGGTGG + Intergenic
1100813268 12:98361469-98361491 GTGTGTGTTCATGCATGTGGTGG + Intergenic
1101915867 12:108895445-108895467 GTGTGTGTGCACGTATGTGGGGG + Intronic
1103173607 12:118843469-118843491 AGGTGTGCACATGCCTGGGGTGG + Intergenic
1103919478 12:124392044-124392066 GTGTGTACACACGCGTGTGGAGG + Intronic
1103971164 12:124673663-124673685 GTGTGTGCACACCTGTGGGTGGG - Intergenic
1104648038 12:130510910-130510932 GTGTGTGGACAAGGAGGGGGAGG + Intronic
1105840854 13:24252617-24252639 GTGTGTACACAGGTACGGGGTGG - Intronic
1106130062 13:26932585-26932607 GTGGGTGCACAGGACTGGGGTGG + Intergenic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1107934436 13:45333426-45333448 GTGTGTGCACACAGGTGGAGTGG - Intergenic
1108146698 13:47484691-47484713 GTGTGTGCATGCGCATGTGCAGG - Intergenic
1108854477 13:54775748-54775770 AGGTGTGCACACACTTGGGGTGG - Intergenic
1110427996 13:75391181-75391203 GTGTGTGTAAACTGATGGGGAGG - Intronic
1111343437 13:86917682-86917704 GTGTGTGCGCGCGCACGTGGTGG - Intergenic
1112284213 13:98089557-98089579 GTGTTTCCCCACCCATGGGGTGG + Intergenic
1112703007 13:102033478-102033500 GTGCGTGCACACGCAAGCGTAGG - Intronic
1113271196 13:108676625-108676647 GTGTGGGCACACACAGAGGGAGG + Intronic
1113355917 13:109580006-109580028 GTGTGTGTACACGTTTGTGGGGG + Intergenic
1113870545 13:113557023-113557045 GTGTGTGCACAGGTATGTGTAGG + Intergenic
1114495161 14:23127087-23127109 GTGTGTGTACTCGCATGTGTTGG + Exonic
1114497479 14:23143019-23143041 GGGTGTGTACATGCAAGGGGAGG + Intronic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1116742828 14:48778025-48778047 GTGTGTGTGCACTCATGGGAAGG + Intergenic
1117070279 14:52049867-52049889 GTGTCTTCACAGGCATCGGGGGG + Intronic
1117252984 14:53953904-53953926 GTGTGTACACGCGCGTGGGCAGG - Intronic
1118693682 14:68363745-68363767 GTGTGTGCACACGCGTGTGTGGG + Intronic
1119758831 14:77137503-77137525 GTGTGAGCACAGGCAGGTGGAGG - Intronic
1120334533 14:83137498-83137520 GTGTGTGCTCACACATGTGCAGG + Intergenic
1120765333 14:88323201-88323223 GTGTGCGCACACGCCTTCGGGGG - Exonic
1120811717 14:88810598-88810620 GTGTGTGCATATGGAAGGGGAGG - Intergenic
1121102327 14:91258510-91258532 GTGTGAGCACACACATCTGGAGG + Intergenic
1121187070 14:91982917-91982939 ATGTGTGCACATGCATGTGTTGG - Intronic
1122806787 14:104263847-104263869 GTCTGTGCACAAGCATGGTGGGG + Intergenic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1124627419 15:31316334-31316356 ATGTGTGCACACCGCTGGGGTGG + Intergenic
1126415552 15:48414398-48414420 GTGTGTGTACACGCATGTGGAGG + Intronic
1128780834 15:70357611-70357633 GTGTGAGCACAGGTCTGGGGTGG - Intergenic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1130235034 15:82125553-82125575 GTATGTGGACTGGCATGGGGTGG + Intergenic
1130369204 15:83269439-83269461 GTGTGTGCGCGCGCATCTGGAGG + Intronic
1132318629 15:100909007-100909029 GGGTTTGCACACGCATGTGGAGG - Intronic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132318644 15:100909101-100909123 GGGTTTGCACACGCACGGAGGGG - Intronic
1132318652 15:100909134-100909156 GAGTTTGCACACACATGTGGAGG - Intronic
1132318674 15:100909275-100909297 GAGTTTGCACACACATGTGGAGG - Intronic
1132318702 15:100909448-100909470 GAGTTTGCACACACATGTGGAGG - Intronic
1132318714 15:100909524-100909546 GAGTTTGCACACACATGTGGAGG - Intronic
1132353301 15:101153981-101154003 GTGTGTGCAGAGGCATGTGTGGG - Intergenic
1134428522 16:14177928-14177950 GTGTGTGTGCACGCATTGGTGGG + Intronic
1136623123 16:31443099-31443121 GTGTGTGCATGCGCATGGCGCGG - Intronic
1136855779 16:33656036-33656058 GTGTGTGCGCGCGCATAGCGGGG - Intergenic
1136913817 16:34163276-34163298 CTGTGTGGTCACGCATTGGGTGG + Intergenic
1137673276 16:50291597-50291619 ATGTCTGCCCACGCAGGGGGTGG + Intronic
1138431808 16:56973564-56973586 GTGTGTGCACACGCATGGGGAGG + Intronic
1138940078 16:61779457-61779479 GTGTGTGTGCGCGCATGGTGAGG + Intronic
1139199423 16:64957585-64957607 GTGTGTGCACGGGCATGTGTGGG - Intronic
1139588193 16:67917739-67917761 CTGTGGGCACAGGCAGGGGGAGG + Intronic
1140268893 16:73445308-73445330 GTGTGTGTATATGTATGGGGGGG + Intergenic
1141141381 16:81498816-81498838 CTGTGTGCACACGCAGGGGCAGG - Intronic
1141661622 16:85444653-85444675 ATGTGTGCACATGCATGGAGAGG - Intergenic
1142382025 16:89738313-89738335 TCGTGTGCACCCGCATGGGAGGG + Exonic
1203117364 16_KI270728v1_random:1504517-1504539 GTGTGTGCGCGCGCATAGCGGGG - Intergenic
1143111940 17:4557914-4557936 GAGTGTGCACCCGCAGGGTGTGG - Exonic
1144172833 17:12676226-12676248 GTGCGTGCGCGCGCAGGGGGAGG - Intronic
1145390291 17:22450554-22450576 GTGTGTGCACATGTGTGGGCCGG - Intergenic
1148741365 17:49894918-49894940 GTGTGTCCACGGGCATTGGGCGG + Intergenic
1151509830 17:74551437-74551459 GTGTGTGCGCACGCATGCACAGG - Intergenic
1151697831 17:75727160-75727182 ATGTGGGCACATGAATGGGGAGG - Intronic
1152287088 17:79419152-79419174 ATGTGTGCACAGGCATGGCCGGG - Intronic
1152375231 17:79915486-79915508 GTGTGTGCACCTGCTTGGGTGGG + Intergenic
1152575410 17:81138176-81138198 GTGTGTGTGCACGCATGTGTGGG - Intronic
1152575445 17:81138440-81138462 GTGTGTGCACATGCATCTGTGGG - Intronic
1152947254 17:83204965-83204987 GTGTGTGTCTACGCATGTGGGGG - Intergenic
1153947992 18:10033482-10033504 GTGTGTGCACCTGCATGTGTGGG + Intergenic
1159774336 18:72585873-72585895 ATGTGGGCACACACTTGGGGTGG - Intronic
1161061504 19:2217419-2217441 CTGTGTGCACAGGGATGGAGAGG + Intronic
1161346551 19:3771303-3771325 GTGTGTGCAAAGACATGGAGGGG - Intronic
1162720804 19:12661465-12661487 TTGGGTGCACAGGCATGGGTGGG + Intronic
1162819283 19:13212763-13212785 GTGTGTGGACAAGGGTGGGGTGG + Intronic
1162968900 19:14168405-14168427 ATGTGTGCACACATACGGGGTGG - Intronic
1163127639 19:15252887-15252909 GTGTGTGTGCACAGATGGGGTGG - Intronic
1163613984 19:18315878-18315900 GAGTGTGGACACTCCTGGGGAGG + Intronic
1164579853 19:29428103-29428125 GAGTGGGCACAGGCAGGGGGCGG - Intergenic
1165196515 19:34108214-34108236 GTGTGTCCACACGTGTGGTGGGG + Intergenic
1166005944 19:39906520-39906542 GTGTGTGCATACGAATGTGTTGG - Intronic
1168153379 19:54460670-54460692 CTGTGGGCACCCGAATGGGGGGG + Intronic
925369169 2:3331139-3331161 GCGTGTGCACACTCATGAGATGG + Intronic
925369177 2:3331245-3331267 GTGTGTACACACTCATGAGATGG + Intronic
926164606 2:10513274-10513296 GTGTGTGCACACAAATGTGGGGG - Intergenic
926581512 2:14635260-14635282 CTGTGTGCGCACGCTCGGGGCGG - Exonic
927350748 2:22110999-22111021 GTGTGTGCACACACATATGTGGG - Intergenic
928225511 2:29444871-29444893 GTATGTGGACAGGCATGGGCAGG - Intronic
930253612 2:49064084-49064106 GTGTTTGCACATGCATGGTGGGG + Intronic
930488086 2:52034128-52034150 GAGTGTGCACAGGCATGAGAGGG - Intergenic
930616723 2:53601733-53601755 CTGTGTTCACACGTATGGAGTGG - Intronic
932001140 2:67886214-67886236 GTGTGTCCTCACACATCGGGAGG + Intergenic
934307881 2:91841275-91841297 GTCTGTGCAGACGCTTGGAGGGG + Intergenic
935600422 2:104916701-104916723 GTGGGTCCACACTCAAGGGGAGG + Intergenic
937018832 2:118632382-118632404 GCGTGTGCACACACATGGACTGG + Intergenic
938083866 2:128385470-128385492 GTGTGTGCACACACAGGTCGGGG + Intergenic
938124403 2:128661479-128661501 GCCAGTGCACAGGCATGGGGTGG + Intergenic
938256463 2:129863392-129863414 GTGTGTGCTCTCCCATGGGTGGG + Intergenic
940456945 2:153913336-153913358 GTGCGTGCACACACATATGGTGG + Intronic
941574397 2:167212898-167212920 GTGTGTGCAGAGGGGTGGGGGGG - Intronic
941751584 2:169140499-169140521 GTGCATGCACCTGCATGGGGGGG + Exonic
944365703 2:198916720-198916742 GTCTGTGGACACGCACAGGGAGG - Intergenic
946271192 2:218595709-218595731 GTGTCTGAACAAGCTTGGGGAGG + Exonic
946431484 2:219629072-219629094 GTGTGTGCCCTCGGGTGGGGAGG + Intronic
946680047 2:222203952-222203974 GTCTATGCACACACATGGGAAGG + Intronic
948072624 2:235140114-235140136 CTGTGTGCACAGGCCTGGGTTGG + Intergenic
948772253 2:240257623-240257645 GTGTGTGTGCACGCGTGTGGAGG - Intergenic
949041410 2:241851603-241851625 AGGTGGGCACACGCATGGGCCGG + Intronic
1170797141 20:19557967-19557989 ATGTGTGTACATGCATGGGTAGG + Intronic
1171347121 20:24474002-24474024 GTGTTTGCACTCACTTGGGGTGG + Intronic
1171810247 20:29741322-29741344 CTGTGTGGTCACGCATTGGGTGG - Intergenic
1171865323 20:30484742-30484764 CTGTGTGGTCACGCATTGGGTGG - Intergenic
1171908728 20:30921849-30921871 CTGTGTGGTCACGCATTGGGTGG + Intergenic
1172303773 20:33867158-33867180 GGGTATGCACACGCATAGGCAGG - Intergenic
1173054322 20:39596761-39596783 GTGTGTGCACACGTGTGTGTGGG + Intergenic
1174403799 20:50291094-50291116 GTGTGTGCACAAGGGTGAGGTGG + Intergenic
1174407268 20:50310502-50310524 GTGTGTGTGCACGTATGGGGTGG + Intergenic
1175138492 20:56842544-56842566 GGGTGGGCACACGCTTGGGGTGG + Intergenic
1175538976 20:59736468-59736490 GGGTGTGCACCTGCATGGGTGGG - Intronic
1176028462 20:62998457-62998479 GTGTGTGTGCATGCATGTGGGGG - Intergenic
1176369731 21:6055582-6055604 GTGTGTGCACATGCATGCACAGG - Intergenic
1179359450 21:40691993-40692015 GTGTGTGCACCCGCATGTGAGGG + Intronic
1179753788 21:43482959-43482981 GTGTGTGCACATGCATGCACAGG + Intergenic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1179950829 21:44707994-44708016 GTGTGTGTGCACGCGCGGGGCGG - Intronic
1180077977 21:45472804-45472826 GTGTGAGCTCATGCGTGGGGGGG - Intronic
1180101896 21:45591238-45591260 GTGTGTGCCCACGCATGCAAGGG - Intergenic
1181786190 22:25228970-25228992 GTGTGTGTGCACGCATGTGTGGG + Intronic
1181895712 22:26105771-26105793 GTGTGTGCAAATGCATGTGTGGG - Intergenic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1182272847 22:29166434-29166456 GTTTGGGCACAGGCATGGGGAGG + Intronic
1182790959 22:32952308-32952330 GTGTGTGGACAGGCAGGGTGGGG + Intronic
1185203243 22:49521381-49521403 ATGTGTGCAGCCACATGGGGTGG - Intronic
949184568 3:1174882-1174904 GTGTGTGCACACGCGTGTGTGGG - Intronic
949331137 3:2923699-2923721 GTGTGTGCACATGCATGAGAAGG - Intronic
950994403 3:17480106-17480128 GGGTGTGCACACACATAGGGCGG + Intronic
951337062 3:21436163-21436185 GTGTGTACACACAGATGAGGGGG + Intronic
951509713 3:23487160-23487182 GGGTGTGCACACACTTGGGGTGG - Intronic
953160583 3:40415857-40415879 GTGGGTGCACCCGCATGGAGTGG + Exonic
955912360 3:63870381-63870403 GTGTGTGCACATGTTGGGGGTGG - Intronic
957031901 3:75251688-75251710 GTGTGTGCGCACGCACGTGGAGG + Intergenic
957673728 3:83339774-83339796 GGGTGTCCACACGCATGTGCAGG + Intergenic
960988140 3:123293561-123293583 GTGTGTGCACACAGGTGAGGAGG + Intronic
961367387 3:126408689-126408711 GTGGGTGCAGAGGCATGGGAGGG + Intronic
963750621 3:149175685-149175707 GTGTGTACCTACACATGGGGAGG + Intronic
965519425 3:169658454-169658476 GGGTGTGCACACGCATGTGTGGG + Intronic
965848681 3:172994548-172994570 GTGTGTGCACACGCACGTGATGG + Intronic
966593003 3:181702016-181702038 GTGCGCGCGCGCGCATGGGGGGG - Intergenic
968564768 4:1305719-1305741 GTGTGTGCGCACGCGTGTGTGGG + Intronic
968840286 4:2999232-2999254 GGGTATGCACACGCCTGGGTGGG + Intronic
968950049 4:3685956-3685978 ATGTGTGCACACGTGTGTGGGGG - Intergenic
968982535 4:3858139-3858161 GCATATGCACAGGCATGGGGTGG - Intergenic
969576170 4:8037259-8037281 GTGTGTGCACATGTATGTGTAGG - Intronic
974229474 4:59091617-59091639 GGGTGTGCACATGCTTGGGGCGG + Intergenic
976800700 4:88988227-88988249 ATGTGTGCACACCCATGTGCAGG - Intronic
977845231 4:101759876-101759898 GTGTGTGCACACGCACATGCAGG + Intronic
978480371 4:109183153-109183175 GTTTGTGGACATGGATGGGGTGG - Intronic
980925441 4:139132434-139132456 GTGTGTGCATGCACATGTGGTGG - Intronic
981430786 4:144656997-144657019 GTGTGTGTACATGCATGCGGTGG - Intronic
982901097 4:161003610-161003632 GGGTGTGCACACGCTTGGGGTGG - Intergenic
985231496 4:187822730-187822752 GTGTGTGCTCATGCATGTTGTGG - Intergenic
985264408 4:188144706-188144728 GTGTCTGCACGTGCAAGGGGGGG - Intronic
985680988 5:1255646-1255668 CTGTATGAACACGCATGTGGAGG + Intronic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
990978257 5:61578069-61578091 GTGTGTGCATACACATGTTGGGG - Intergenic
991454931 5:66792861-66792883 GTGTGTGTTCAAGTATGGGGGGG + Intronic
992472853 5:77075556-77075578 CTATGTACACATGCATGGGGTGG + Exonic
993485861 5:88484241-88484263 GTGTGTGTACATGCATGTGCAGG - Intergenic
993807534 5:92430339-92430361 TTGTATGCACACACATGAGGAGG + Intergenic
994106948 5:95959962-95959984 CTGTGTGCACACTTATGGGGTGG + Intronic
997479960 5:134177352-134177374 GTGTGTGTTCACTCCTGGGGGGG + Intronic
998148611 5:139744631-139744653 GTGTGTACACACACATGGGGAGG - Intergenic
1000171889 5:158710313-158710335 GTGTCTGCACAGGCTTGGGGAGG + Intronic
1000420535 5:161033654-161033676 GTGTGTGTGCGCGCATTGGGTGG + Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1001550152 5:172596675-172596697 GTGTGTGCATACATGTGGGGGGG - Intergenic
1004849214 6:19679527-19679549 GTGTGTGCGCGCGCATGTGGTGG + Intergenic
1005999433 6:30953842-30953864 GTGGGTGGACACGCAAGGAGGGG + Exonic
1006212152 6:32405122-32405144 GTTTGTGCACAGGGATGGAGTGG - Exonic
1006233207 6:32603366-32603388 GTATGTGCACATGCATATGGTGG - Intergenic
1007263578 6:40581026-40581048 GTATGTGCACATGTATGTGGTGG + Intronic
1007406643 6:41639370-41639392 GTGTGTGCACAGGGCAGGGGCGG - Intronic
1007951709 6:45878377-45878399 TTGTGTGCACTGGAATGGGGAGG + Intergenic
1008821286 6:55634259-55634281 GTGTGTGGAGGGGCATGGGGAGG + Intergenic
1008892809 6:56514612-56514634 GTGTGTGTATGCGCATGAGGGGG - Intronic
1009965382 6:70572814-70572836 GTGTGTGCACATGCATGCACAGG + Intronic
1010002565 6:70962480-70962502 TTGTGTGCACACGCATGCATGGG + Intergenic
1010354895 6:74921317-74921339 GTGTGTGCACGCTCATGAGTAGG - Intergenic
1010567034 6:77428716-77428738 GTGTGTGCACACGCATGTGTGGG + Intergenic
1011159435 6:84371788-84371810 GTGTGTGCACGCGCATATGATGG + Intergenic
1013193506 6:107824889-107824911 GTGTGTGCACACACCTGGATAGG - Intergenic
1015002773 6:128239910-128239932 GCGTGTGCACACGCATGTAGTGG - Intronic
1019115974 6:169763011-169763033 GTGTGTGTACACACATGGAGGGG - Intronic
1019205224 6:170355937-170355959 GTGTGTGCACAACAATGGGAAGG + Intronic
1019246247 6:170712345-170712367 GTGTGTGTCTACGCATGTGGGGG - Intergenic
1019295734 7:273049-273071 GTGTGTGCACACGAGTGTGTGGG - Intergenic
1019778607 7:2926840-2926862 GTGTGTGCACACGCAGGCAAGGG + Intronic
1019879511 7:3846189-3846211 GTGTGTGTACATGCATGTGTTGG - Intronic
1020975437 7:15000306-15000328 GTGTGTGCACAAGGATGAGAAGG - Intergenic
1022344381 7:29500150-29500172 GTGTGTGCGCACACATGCGTAGG - Intronic
1022391824 7:29950266-29950288 GGGTGTGCACATGCTTAGGGTGG + Intronic
1022903698 7:34835225-34835247 GTGTGTGCACAAGGAATGGGAGG - Intronic
1024006127 7:45225897-45225919 GTGTGTGCACACACGTGTGGTGG + Intergenic
1024607116 7:51031095-51031117 GTGTGTGCACAGGTATGTGTGGG + Intronic
1024857097 7:53794780-53794802 GGTTGTGCACATGCTTGGGGTGG - Intergenic
1026426433 7:70298933-70298955 GTGTGTGCACCCGTGTGGGCTGG - Intronic
1026678480 7:72447744-72447766 GTGTGTGTACATGTATGGGTAGG - Intergenic
1030062474 7:105633928-105633950 GTGTGTGCACACACACCAGGAGG + Intronic
1031526822 7:122832318-122832340 GTGTGTGTGCACACATGGGTGGG - Intronic
1031913883 7:127544730-127544752 GTGTATGCTCAGTCATGGGGAGG - Intergenic
1032709605 7:134450414-134450436 GTGTGTGCACGTGCCTGGAGGGG + Intronic
1033085371 7:138336381-138336403 GTGTGTGCACACTGAGGTGGAGG - Intergenic
1034783098 7:153899786-153899808 GTGTGTGCACAGGCAGGTGCAGG + Intronic
1035067302 7:156116261-156116283 GTGTGTGCACATGAATGCTGTGG - Intergenic
1035098471 7:156376932-156376954 GTGTGTGCACACATATGTGCAGG - Intergenic
1035167866 7:157002479-157002501 GGGCGTGCAAACGCATGTGGAGG - Intronic
1035501824 8:95344-95366 GTGTGTGTCTACGCATGTGGGGG + Intergenic
1035628544 8:1091530-1091552 GTGTGTGCACACACATAGGTGGG - Intergenic
1036561759 8:9904721-9904743 GTCCGTGCACATGCATGAGGCGG - Intergenic
1040537190 8:48320700-48320722 ATGTGTGCTCATGCATGGAGAGG + Intergenic
1041274351 8:56142223-56142245 AGGTGTGCACACACTTGGGGTGG + Intergenic
1042835035 8:73072036-73072058 GTGTGTGCACACAGATCGGTAGG + Intronic
1044311085 8:90693353-90693375 GTGTGTGCACGCACATGTGTAGG + Intronic
1044630277 8:94271883-94271905 GTGTGTGCACATGTGGGGGGAGG + Intergenic
1044630284 8:94271918-94271940 GTGTGTGCACATGTGGGGGGAGG + Intergenic
1044630290 8:94271953-94271975 GTGTGTGCACATGTCGGGGGAGG + Intergenic
1048341375 8:133541505-133541527 GTGTGTGTAGACGCACGTGGTGG - Intronic
1048560595 8:135532553-135532575 GTGTGTGTACACACACGGAGTGG + Intronic
1048737103 8:137514110-137514132 GTGTGTGCACACAAATGAGTAGG + Intergenic
1049044690 8:140140107-140140129 GGGTGAGCACACGCAGGGGCAGG + Intronic
1049246327 8:141564687-141564709 GTGTGTGCAAAGGCCTGTGGTGG + Intergenic
1049298856 8:141859145-141859167 GTGTGAGGACACACATGGAGAGG + Intergenic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1049956202 9:695452-695474 GTGTGTGCACACGCACTGCTTGG - Intronic
1050347122 9:4701601-4701623 TTGTGTGCATATGCATAGGGAGG + Intronic
1053434061 9:38063592-38063614 GTGTGTGCACAGGGTTGGGAGGG - Intronic
1053730176 9:41046445-41046467 ATGTGTGCACACGCATGGGATGG - Intergenic
1054698325 9:68385618-68385640 ATGTGTGCACATGCATGGGATGG + Intronic
1054785600 9:69207113-69207135 GTGTGTACGCACGCATGCAGTGG - Intronic
1059319856 9:113461221-113461243 GTGTGTGCACATGTGTGAGGTGG + Intronic
1060794048 9:126502962-126502984 GTGCGTGGACACGCCTGCGGGGG - Intronic
1061799259 9:133105194-133105216 GTGTGTGTCCACGCAGGAGGGGG + Intronic
1062119923 9:134828983-134829005 GTGTGTGCGCGTGCATGGTGTGG - Intronic
1062267050 9:135691776-135691798 GTGTGTGCACACGCGTTCGTGGG - Intergenic
1203607012 Un_KI270748v1:67728-67750 GTGTGTGTCTACGCATGTGGGGG - Intergenic
1187977568 X:24718705-24718727 GCGTGTGCACACACACGTGGAGG + Intronic
1191841398 X:65515794-65515816 GTGTGTACACATGTGTGGGGAGG - Intronic
1192238643 X:69312672-69312694 GTCTGTGCCCATACATGGGGTGG - Intergenic
1194085690 X:89524980-89525002 CGGGGTGCACACGCATGGGCTGG + Intergenic
1195117063 X:101709729-101709751 GTGTGTGCACACGTATGCATGGG + Intergenic
1197559848 X:128006303-128006325 GTGTGTGCACGCGCACGCGTGGG - Intergenic
1198502816 X:137269385-137269407 GTGTGTGTGCACGCATGACGCGG - Intergenic
1198871583 X:141181248-141181270 ATGTGTGCACACTCATCTGGTGG - Intergenic
1199559414 X:149147013-149147035 GAGTGTGCACATGCTTGGGGTGG + Intergenic
1200111085 X:153741209-153741231 GTTTGTGCAGACGCTTGGAGGGG + Intronic
1200438336 Y:3180863-3180885 CGGGGTGCACACGCATGGGCTGG + Intergenic
1200906299 Y:8486076-8486098 GTGTGTGCACATTGATGGTGTGG - Intergenic