ID: 1138433234

View in Genome Browser
Species Human (GRCh38)
Location 16:56982699-56982721
Sequence ACCATAGCACACGTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138433230_1138433234 12 Left 1138433230 16:56982664-56982686 CCCTTTGAGGTGACTCGGATGGT 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1138433234 16:56982699-56982721 ACCATAGCACACGTGTGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 81
1138433231_1138433234 11 Left 1138433231 16:56982665-56982687 CCTTTGAGGTGACTCGGATGGTA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1138433234 16:56982699-56982721 ACCATAGCACACGTGTGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138433234 Original CRISPR ACCATAGCACACGTGTGCTG GGG Intronic
903224760 1:21888225-21888247 CCCATGCCCCACGTGTGCTGTGG - Intronic
907275968 1:53316816-53316838 ACCAGAGCACACATGGCCTGGGG + Intronic
910140534 1:84022201-84022223 ACCATATCACAGGTGTACTATGG + Intergenic
910140535 1:84022202-84022224 ACCATAGTACACCTGTGATATGG - Intergenic
923419389 1:233797643-233797665 ACCATAGCACACGTTTACCTAGG - Intergenic
1067450343 10:46378208-46378230 ACCACAGCCCCCGAGTGCTGGGG + Intronic
1067586902 10:47481555-47481577 ACCACAGCCCCCGAGTGCTGGGG - Intronic
1067633958 10:47989322-47989344 ACCACAGCCCCCGAGTGCTGGGG - Intergenic
1069618202 10:69819727-69819749 ACCACAGCACCCATGAGCTGTGG + Intronic
1069618203 10:69819728-69819750 ACCACAGCTCATGGGTGCTGTGG - Intronic
1070542903 10:77429547-77429569 ACCATAGAATACTTGTGTTGGGG - Intronic
1084627673 11:70320988-70321010 CCCATAGCACTAGTGTTCTGTGG - Intronic
1092109793 12:5951337-5951359 ACAACAGCCCACATGTGCTGTGG - Intronic
1100439430 12:94602421-94602443 ACCATAGCAAACATGTGCACTGG + Intronic
1101158676 12:101952038-101952060 AACATGGCACCGGTGTGCTGGGG - Intronic
1110492914 13:76129859-76129881 TCCATAGTACATGTGTGCTGGGG + Intergenic
1111124098 13:83890627-83890649 GCCATAGCACCCATCTGCTGAGG - Intergenic
1111386126 13:87530157-87530179 ACCCTAGCACACTTTTGGTGGGG + Intergenic
1120157947 14:81114613-81114635 ACCATTGCACAGGCGTGCTTAGG + Intronic
1125265702 15:37878290-37878312 AACATAGGCCAGGTGTGCTGTGG - Intergenic
1128193203 15:65724493-65724515 AACATAGCACAGGTGTGTAGTGG + Intronic
1128768824 15:70266897-70266919 TCCATAGCCCACGTGCGATGGGG - Intergenic
1129583018 15:76831854-76831876 AGCACAGCACTCCTGTGCTGTGG - Intronic
1131112492 15:89774215-89774237 GCCAGAGCACACCTGGGCTGGGG - Intronic
1134108599 16:11500817-11500839 ACCATAGCATCTGTGGGCTGTGG + Exonic
1138433234 16:56982699-56982721 ACCATAGCACACGTGTGCTGGGG + Intronic
1138433235 16:56982700-56982722 CCCCCAGCACACGTGTGCTATGG - Intronic
1150376843 17:64688488-64688510 ACCATAGCACTTGAGTGCAGTGG - Intergenic
1150455219 17:65301840-65301862 ACCATAGAACACTTTTGGTGAGG - Intergenic
1151635916 17:75347695-75347717 GCCATAACACAGGTGAGCTGGGG + Intronic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1154213996 18:12402069-12402091 ACCATAGCTCAGGTAGGCTGAGG + Intergenic
1158107723 18:53904665-53904687 ACCATTGGACACGAGGGCTGAGG - Intergenic
1164478452 19:28593086-28593108 ACCAAAGCACCCCTGTGCTAAGG - Intergenic
1165702408 19:37948631-37948653 GCCATGGCACACAAGTGCTGGGG + Intronic
1168388478 19:55986556-55986578 ACCACCACACACCTGTGCTGAGG - Intronic
926716967 2:15932426-15932448 ACCATAGCATGTGTGTCCTGGGG - Intergenic
930977064 2:57477008-57477030 ACCATAGCACACGTATACCTAGG - Intergenic
936050818 2:109222592-109222614 TCCAGGGCACACGCGTGCTGTGG - Intronic
936097921 2:109547926-109547948 CCCTTAGCACACATGTGCTGGGG + Intronic
936097922 2:109547927-109547949 ACCCCAGCACATGTGTGCTAAGG - Intronic
938249554 2:129804021-129804043 ATCATGGCACATCTGTGCTGTGG - Intergenic
938560522 2:132468683-132468705 GCCATAGCTTACGTGTGCAGTGG + Intronic
938797601 2:134731443-134731465 TCCATAGCACACTTGGGCTTGGG - Intergenic
941149232 2:161893240-161893262 AACATAGCACATGTGTGCGGAGG + Intronic
946452759 2:219795056-219795078 ACCAAAGCACATGGGAGCTGGGG + Intergenic
948347153 2:237308214-237308236 ACCATAGCCCACCTGTTCTCTGG - Intergenic
1173563392 20:44022070-44022092 GCCATTGCTCACTTGTGCTGTGG - Intronic
1177444313 21:21172032-21172054 AGCATAACACACATGGGCTGTGG + Intronic
1179236328 21:39550300-39550322 ACCATGGCACATGTATACTGAGG - Intergenic
1179363513 21:40734383-40734405 AGCATGGCACCCATGTGCTGTGG - Intronic
1183433455 22:37779934-37779956 TCCATAGCCCCCATGTGCTGAGG - Intergenic
1184601939 22:45548943-45548965 TCCAGAGGACAAGTGTGCTGGGG - Intronic
956057815 3:65319093-65319115 ACCATAGTACATCTGTGCTATGG + Intergenic
958170054 3:89927975-89927997 ACTATAACACAGGTGAGCTGGGG + Intergenic
962872506 3:139509851-139509873 ACCAGAGCACCTGTGAGCTGAGG + Intergenic
965906271 3:173710596-173710618 GACATTGCACTCGTGTGCTGTGG - Intronic
977325562 4:95571517-95571539 ACCATAGCACTACTGGGCTGGGG - Intergenic
979188635 4:117831544-117831566 ACTATAGCACACGCACGCTGGGG - Intergenic
988782710 5:34538000-34538022 GCTATAACACAGGTGTGCTGGGG - Intergenic
1005806064 6:29475517-29475539 ACCATGGCAGAGGTGTGCTCTGG + Intergenic
1013284624 6:108670680-108670702 ACCATAGCACCAGTGTTCTAAGG + Intronic
1019938858 7:4273649-4273671 GCCAGGCCACACGTGTGCTGAGG - Intergenic
1021958430 7:25849941-25849963 ACCCTTGTACACGTTTGCTGTGG - Intergenic
1022718088 7:32916637-32916659 ACAAGAGCACAGGTGGGCTGTGG + Intergenic
1027837671 7:83265642-83265664 ACCGTGGCACACGTATGCTATGG + Intergenic
1027837672 7:83265643-83265665 TCCATAGCATACGTGTGCCACGG - Intergenic
1030641803 7:112014527-112014549 ACCATGACTCACATGTGCTGAGG + Intronic
1032540602 7:132699853-132699875 GCCAAAGCACAGGTGTGATGCGG + Intronic
1034450031 7:151132351-151132373 ACTTTAGCACATGTGTGCTCAGG + Intronic
1036475818 8:9092379-9092401 ACCATTGCACACATGGCCTGTGG + Intronic
1036938403 8:13027430-13027452 CCTATAGCGCACGTGTTCTGTGG + Exonic
1044256476 8:90069467-90069489 ACCTGAGCACAGGTCTGCTGCGG - Intronic
1044594166 8:93942115-93942137 ACTATAACACAGGTGAGCTGGGG - Intergenic
1044834546 8:96282995-96283017 ACCATAGCCCATGCTTGCTGGGG - Intronic
1048807855 8:138257220-138257242 ACCATTGCCCACGTGTCCAGAGG + Intronic
1049832550 8:144711305-144711327 GCCATAGCGCACTTGTACTGGGG + Intergenic
1050793414 9:9504451-9504473 ACCATAGTAAATGTGTGTTGGGG - Intronic
1056318792 9:85417426-85417448 ATGAAAGCACACGTGTGATGTGG + Intergenic
1059923976 9:119187538-119187560 ACCATAGGACACATCTGCAGGGG + Intronic
1062067064 9:134534237-134534259 TCCAGAGCACACGGGGGCTGGGG - Intergenic
1187617031 X:21006928-21006950 AGCAAAGCACACGGGAGCTGGGG + Intergenic
1192961869 X:76139536-76139558 ACCATAACAGAGGTGTGTTGTGG + Intergenic
1197805496 X:130394697-130394719 ACCAGAGCACATGAGTGCTCGGG - Intergenic
1198497457 X:137206679-137206701 ACAATGGCACACGTGTGCCATGG + Intergenic