ID: 1138433916

View in Genome Browser
Species Human (GRCh38)
Location 16:56986512-56986534
Sequence CTGCTGACCTTGGGCAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138433902_1138433916 20 Left 1138433902 16:56986469-56986491 CCCCAAGGCCAGCACCAGGCAGA No data
Right 1138433916 16:56986512-56986534 CTGCTGACCTTGGGCAGGATGGG No data
1138433905_1138433916 12 Left 1138433905 16:56986477-56986499 CCAGCACCAGGCAGAAGCACATC No data
Right 1138433916 16:56986512-56986534 CTGCTGACCTTGGGCAGGATGGG No data
1138433909_1138433916 -10 Left 1138433909 16:56986499-56986521 CCTGCCACCTGGGCTGCTGACCT No data
Right 1138433916 16:56986512-56986534 CTGCTGACCTTGGGCAGGATGGG No data
1138433903_1138433916 19 Left 1138433903 16:56986470-56986492 CCCAAGGCCAGCACCAGGCAGAA No data
Right 1138433916 16:56986512-56986534 CTGCTGACCTTGGGCAGGATGGG No data
1138433906_1138433916 6 Left 1138433906 16:56986483-56986505 CCAGGCAGAAGCACATCCTGCCA No data
Right 1138433916 16:56986512-56986534 CTGCTGACCTTGGGCAGGATGGG No data
1138433904_1138433916 18 Left 1138433904 16:56986471-56986493 CCAAGGCCAGCACCAGGCAGAAG No data
Right 1138433916 16:56986512-56986534 CTGCTGACCTTGGGCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138433916 Original CRISPR CTGCTGACCTTGGGCAGGAT GGG Intergenic
No off target data available for this crispr