ID: 1138434378

View in Genome Browser
Species Human (GRCh38)
Location 16:56989127-56989149
Sequence CAGGATGAACTAGGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138434378_1138434386 0 Left 1138434378 16:56989127-56989149 CCCTTCTCCCCTAGTTCATCCTG No data
Right 1138434386 16:56989150-56989172 GAGGCTCTCCGCTCTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138434378 Original CRISPR CAGGATGAACTAGGGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr