ID: 1138439481

View in Genome Browser
Species Human (GRCh38)
Location 16:57025588-57025610
Sequence CAGGGTTAACAAGGGCCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138439481 Original CRISPR CAGGGTTAACAAGGGCCCGA GGG Exonic
900214068 1:1471899-1471921 CGGCGTTAACAAGGGCCCCAAGG + Exonic
900221617 1:1512283-1512305 CGGCATTAACAAGGGCCCCAAGG + Exonic
902330942 1:15731024-15731046 CAGGGTGAAGAAGGGCCTGGGGG - Intronic
905169069 1:36099100-36099122 CAGGGGGAACCAGGGCCCCAGGG - Exonic
907513442 1:54979139-54979161 CAGGTTGAAGCAGGGCCCGAGGG + Intergenic
1076293808 10:129368219-129368241 CATGGTCTCCAAGGGCCCGAGGG + Intergenic
1077249589 11:1555143-1555165 CAGGGGTCCCAATGGCCCGAGGG + Exonic
1083781968 11:64923431-64923453 CAGGGACACCAAGGGCCGGATGG + Intronic
1089301362 11:117501086-117501108 CATGGGTAACCAGGTCCCGAAGG + Intronic
1103793895 12:123490324-123490346 CTGGGTTATCAAGGGCTAGATGG - Intronic
1118615150 14:67569928-67569950 CAGGGGAAACAAGGGCAGGAGGG - Exonic
1128342539 15:66832385-66832407 GGGGGTCAACAAGGGCCCCAGGG + Intergenic
1131512230 15:93055757-93055779 CAGGGTGAGCAGGGGCTCGACGG + Intronic
1132178073 15:99731623-99731645 CAGGGTTAAGAAGGGCGGCAAGG + Intronic
1138439481 16:57025588-57025610 CAGGGTTAACAAGGGCCCGAGGG + Exonic
1142162064 16:88562729-88562751 CAGGGCTAACCTGGGCGCGATGG + Intergenic
1142290086 16:89190111-89190133 CAAGGTTAAAAAGGGGCAGAAGG + Intronic
1147204076 17:38824384-38824406 CAGGCTTAAAAAGGACCCCAGGG + Intronic
1147213920 17:38888049-38888071 CAGGGCTAAAAATGGCCTGACGG + Intronic
1147567537 17:41547030-41547052 CAGGGATCACAAAGGCCTGAAGG - Intergenic
1154427963 18:14286632-14286654 CAGTGTTAAAAAGGCCCTGAAGG + Intergenic
1155495381 18:26437160-26437182 CAGGGTTGACAAGGCGCCCAAGG - Intergenic
1157563203 18:48663116-48663138 CAGGGGTAAGAAGGGCTGGAGGG + Intronic
1160280462 18:77485463-77485485 GAGGTTTAACAAGGTCCAGAAGG - Intergenic
1168410366 19:56136133-56136155 CGTGGTTAATAAGGGCCCAAGGG - Intronic
925021814 2:575578-575600 CAGGGTGTGCAAGGGCCAGAAGG + Intergenic
929572779 2:43033127-43033149 CACGGGTGACAAGGGCCCCATGG - Intergenic
930340824 2:50112279-50112301 CAGGGGTAATAAGGACCCAAGGG - Intronic
935562710 2:104575394-104575416 CAGAGTTAAAAAGGGCCCTTGGG + Intergenic
947525006 2:230872326-230872348 AAGGGTGAGCAAGGGCCCGGGGG + Intronic
1170636067 20:18105777-18105799 CAGGGTTTCCAAGGACACGATGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173319224 20:41972489-41972511 CATGGTGAGCAAGGGCCCCAGGG - Intergenic
1181924203 22:26345122-26345144 CAAAGTTAACAAGGGCCCATGGG + Intronic
1182146162 22:27998110-27998132 CAGGGGTAACAAGGGGATGATGG - Intronic
961453076 3:127011281-127011303 CAGAGTTAACAAGGCCCAGCTGG - Intronic
968755591 4:2414207-2414229 CTGGGTTAACAAGAGCCGAAGGG + Intronic
970947347 4:21710595-21710617 CAGAGTTCACATGGGGCCGAAGG - Intronic
973050146 4:45586007-45586029 CAGGGTACATAAGGGCCCTAGGG + Intergenic
991236486 5:64405508-64405530 CATGGTAACCAAGGGCCTGATGG + Intergenic
991620362 5:68539036-68539058 CAGGGCTCACAAGAGCCCTAAGG + Intergenic
996635472 5:125684095-125684117 AAGGGAAAACAAGGGCCTGAGGG - Intergenic
1000932965 5:167274158-167274180 CAGGGTTAAGAAGGGTATGATGG - Intergenic
1004198997 6:13530824-13530846 CAGGTATAACCAGGGCCAGAGGG + Intergenic
1006109449 6:31735911-31735933 CAGGGTTTAGAAGGGACAGAGGG - Intronic
1007236487 6:40394194-40394216 CAGGCTTAACAAGGTCACAAGGG - Intronic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1011836447 6:91436761-91436783 CATGGATAACATGGGCCCCACGG - Intergenic
1019613484 7:1948385-1948407 GAGGGTTCACCAGGGCCTGAGGG + Intronic
1020365947 7:7380676-7380698 TAGGGTTTACAAGGACCCAAAGG - Exonic
1022959253 7:35410572-35410594 CAGTGTTAAGAAGGGCTTGAGGG - Intergenic
1037876830 8:22552539-22552561 CAGGGTTGAGAAGGGGCAGATGG + Intronic
1037986287 8:23292651-23292673 CAGAGTTAACAAGGGCCACGTGG - Intronic
1045273913 8:100684612-100684634 CAGTGTTAACAAGATCCCTAGGG - Intergenic
1048163692 8:132043286-132043308 CAGGGTTAACAGGAGGCCTATGG - Intronic
1048857104 8:138694860-138694882 CAGGGAGAACAAGGGCCCAAAGG - Exonic
1059480679 9:114587128-114587150 CAGGGCAAACAAGGTCCCGGCGG - Intergenic
1062433254 9:136535250-136535272 CAGGGTTCACAAGGCCCCTTGGG + Intronic
1186732609 X:12426356-12426378 CAGGGCTAAGAGGGGCCTGAGGG + Intronic
1188326341 X:28806919-28806941 GAGGGTTTACAAGGTCCCAACGG - Intronic
1191252185 X:58264970-58264992 AAGGGTCAAGAAGGCCCCGAGGG + Intergenic
1195756370 X:108202962-108202984 CAGGGTGAACCAGGGCCTAAGGG - Exonic