ID: 1138443189

View in Genome Browser
Species Human (GRCh38)
Location 16:57047251-57047273
Sequence ATGGTCAAGGTGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 899
Summary {0: 1, 1: 0, 2: 10, 3: 74, 4: 814}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138443186_1138443189 -9 Left 1138443186 16:57047237-57047259 CCAGAGGGTGTTAAATGGTCAAG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG 0: 1
1: 0
2: 10
3: 74
4: 814
1138443185_1138443189 -8 Left 1138443185 16:57047236-57047258 CCCAGAGGGTGTTAAATGGTCAA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG 0: 1
1: 0
2: 10
3: 74
4: 814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138443189 Original CRISPR ATGGTCAAGGTGAGTGAGGA TGG Intronic
900194875 1:1371126-1371148 ATGGTCCTGGTCAGTGGGGATGG - Intergenic
901051030 1:6425983-6426005 ATGTTCAGAGTGGGTGAGGAAGG + Intronic
901485733 1:9559757-9559779 ATAATCCAGGTGAGAGAGGATGG - Intronic
901751056 1:11409010-11409032 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
902185899 1:14725240-14725262 TAGATGAAGGTGAGTGAGGAGGG - Intronic
902280066 1:15367837-15367859 TTGGTGAGGGTGAGTGAGGGAGG - Intronic
902801317 1:18831922-18831944 TGGGCCCAGGTGAGTGAGGATGG - Intergenic
902940825 1:19799470-19799492 CTGGTCAAGGTCAGAGAGGAAGG - Intronic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
904330062 1:29753003-29753025 AAGGTCCAGGTGAGAGATGATGG + Intergenic
904665386 1:32116739-32116761 ATGATTAAGCTTAGTGAGGAAGG - Intronic
904683868 1:32247270-32247292 ATGTTCAAGGTGGGTTAGGGGGG - Exonic
904851517 1:33463164-33463186 ATGGTCAGGCTGGGTGGGGATGG - Intergenic
904925788 1:34047199-34047221 ATGGTTAGAGTGAGTGAGCAGGG - Intronic
905359792 1:37411340-37411362 CTGGTCAGGGTGGGTGTGGAGGG - Intergenic
905545869 1:38800288-38800310 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
905892947 1:41528489-41528511 AGTGTGAAGGTGAGTGAGGGTGG - Intronic
906160950 1:43649035-43649057 ATTGTCAAGGGTAGTGGGGAAGG - Intergenic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
907548137 1:55280284-55280306 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
907802496 1:57784042-57784064 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
908340769 1:63176504-63176526 ATGGTTAAGCTTAGTGACGAAGG - Intergenic
908768353 1:67573786-67573808 GTGGTCAAGGAGAGTGAGTGAGG - Intergenic
908975401 1:69891161-69891183 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
909147287 1:71952158-71952180 ATGATTAAGGTTAGTGAGGAAGG + Intronic
909480079 1:76121319-76121341 ATAGCCCAGGTGAGTGAGGGTGG - Intronic
909617869 1:77632798-77632820 AAGGTGAATGTCAGTGAGGAAGG - Exonic
909964348 1:81889195-81889217 ATGATTAAGCTTAGTGAGGAAGG + Intronic
910072021 1:83228096-83228118 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910076401 1:83284752-83284774 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910200457 1:84692958-84692980 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910298403 1:85676496-85676518 ATGATTAAGCTTAGTGAGGAAGG - Intronic
910640091 1:89451036-89451058 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
910718663 1:90260244-90260266 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
910732705 1:90415503-90415525 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
910918199 1:92314209-92314231 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911199097 1:95026307-95026329 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911591394 1:99752290-99752312 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911868406 1:103058526-103058548 ATGATTAAGCTTAGTGAGGAAGG - Intronic
912307194 1:108580444-108580466 ATGATTAAGCTTAGTGAGGAAGG + Intronic
912445625 1:109733923-109733945 ATGGACATGGAGAGTGAGTAGGG + Exonic
913207322 1:116552062-116552084 ATGATTAAGCTTAGTGAGGAAGG - Intronic
913223299 1:116676783-116676805 ATGGTCCAAGTGAGAGATGATGG + Intergenic
913281341 1:117187931-117187953 ATTGTCAAAGTGAGTGAAGTGGG - Intronic
913966840 1:143383653-143383675 ATGGTCCAGGTGAGAGAGGCCGG + Intergenic
914774559 1:150724610-150724632 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
916566681 1:165985065-165985087 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
917167945 1:172134111-172134133 ATGGTCCAGGCAAGAGAGGATGG + Intronic
917729644 1:177862010-177862032 ATGGTCCAGGTGAGGGAAGATGG - Intergenic
917766162 1:178219736-178219758 ATGATTAAGCTTAGTGAGGAAGG - Intronic
917993542 1:180409868-180409890 ATGATTAAGCTTAGTGAGGAAGG + Intronic
918130682 1:181625844-181625866 ATGATTAAGCTTAGTGAGGAAGG - Intronic
918540642 1:185628255-185628277 GTAGTAAAGGTGAGTGGGGAAGG + Intergenic
918582673 1:186149685-186149707 ATGGTTAAGCTGAGAGAGGCAGG - Intronic
918585900 1:186188050-186188072 TTGGTCAAGGAGTGGGAGGAAGG - Intronic
918849574 1:189668960-189668982 ATGGTTAAACTTAGTGAGGAAGG + Intergenic
918924322 1:190761495-190761517 GTAGTGAAGGTGAGGGAGGATGG + Intergenic
919776955 1:201200445-201200467 ATGGTCCAGGTGTGTGGGGTGGG - Intronic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
919932764 1:202232163-202232185 CTGGTTAAAGTGAGTGAAGAGGG + Intronic
920218787 1:204380137-204380159 CTGGTCAAGGTCACTGAGAAGGG + Intergenic
920538324 1:206756520-206756542 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
920679327 1:208060515-208060537 AGGGTGGAGGTGAGGGAGGAGGG + Intronic
921141901 1:212316177-212316199 ATGATTAAGCTTAGTGAGGAAGG + Intronic
921204167 1:212833911-212833933 ATGATTAAGCTTAGTGAGGAAGG - Intronic
921301709 1:213757212-213757234 ATAGTTAAGCTTAGTGAGGAAGG + Intergenic
921307945 1:213815868-213815890 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
921308238 1:213818242-213818264 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
921571736 1:216787698-216787720 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
921828868 1:219704460-219704482 ATGATTAAGTTTAGTGAGGAAGG + Intronic
922588659 1:226755367-226755389 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
922727948 1:227933562-227933584 ATGATTAAGATTAGTGAGGAAGG - Intronic
922823387 1:228500585-228500607 ATGATCAATCTTAGTGAGGAAGG - Intergenic
923014678 1:230117425-230117447 ATGATTAAGCTTAGTGAGGAAGG - Intronic
923109470 1:230879627-230879649 AGGGGCAGGGTGACTGAGGAGGG - Intergenic
923109483 1:230879665-230879687 AGGGGCAGGGTGATTGAGGAGGG - Intergenic
923371995 1:233323868-233323890 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
923763175 1:236866575-236866597 ATGATTAAGTTTAGTGAGGAAGG + Intronic
923898293 1:238297159-238297181 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
924499838 1:244627000-244627022 ATGATTAAGCTTAGTGAGGAAGG - Intronic
924529467 1:244881143-244881165 ATTGACAAGTTGAGGGAGGAAGG + Intergenic
924614094 1:245598549-245598571 GTGGTCACGGTGAGAGATGACGG + Intronic
1062777214 10:162013-162035 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062808351 10:442141-442163 ATGGCCAGTGTGAGTGAAGACGG + Intronic
1062893898 10:1088342-1088364 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062986192 10:1771518-1771540 CTGGTCAAGGTGACTGAGATAGG - Intergenic
1065064818 10:21950584-21950606 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1065872175 10:29964882-29964904 ATAGTCCAGGTGAGAGATGATGG + Intergenic
1066043377 10:31575773-31575795 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066134934 10:32435942-32435964 ATGATTAAGCTGACTGAGGAAGG - Intergenic
1066266903 10:33784815-33784837 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066478959 10:35776883-35776905 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1066724005 10:38371017-38371039 CTGCCCAAGGTGAGTGAGGCTGG - Intergenic
1067301887 10:45019184-45019206 ATGGTTAAGCTTAGTGGGGAAGG - Intergenic
1067440645 10:46307631-46307653 ATGGTGCAGGTGGGTGAGGCTGG + Intronic
1067808614 10:49410098-49410120 AGGGTCAAGGACAGTGAGTAAGG - Intergenic
1068127105 10:52853919-52853941 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1068327994 10:55519397-55519419 AAAGTCAAGGTGTGTGGGGACGG + Intronic
1068748730 10:60566374-60566396 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1068940890 10:62680019-62680041 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1069342892 10:67433083-67433105 ATAGTTAAGTTCAGTGAGGAAGG - Intronic
1069470789 10:68687466-68687488 ATGGTAAAGGTGACCAAGGAAGG - Intronic
1069480991 10:68781920-68781942 ATCGTTAAAGTGAGTGAAGAAGG + Intronic
1069736401 10:70657853-70657875 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1070068793 10:73065530-73065552 ATGGTGGGGGTGAGGGAGGAAGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070420780 10:76235042-76235064 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1070817684 10:79335645-79335667 GAGGTCAAGGTGAGAGAGGCAGG - Intergenic
1070944734 10:80380542-80380564 ATGGTTAGGCTTAGTGAGGAAGG - Intergenic
1070972455 10:80578805-80578827 ATGGTCAAGGCCAATGAGCAAGG + Intronic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1071662990 10:87524593-87524615 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1071827142 10:89336384-89336406 AAGGGCAATGGGAGTGAGGAGGG - Intronic
1071851634 10:89577597-89577619 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1071871819 10:89803882-89803904 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1072630142 10:97140076-97140098 ATGGTCAGGGTGAGGGATGGCGG - Intronic
1072755827 10:98020088-98020110 ATTGTTCAGGTGAGTGAGAAAGG - Intronic
1073287338 10:102396815-102396837 ACTGTCAAGGTGAGCCAGGATGG + Exonic
1073712465 10:106059696-106059718 ATGGTCAAGGTAATTGAATAGGG + Intergenic
1074090918 10:110254520-110254542 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1074210714 10:111331679-111331701 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074584827 10:114757661-114757683 ATGGTCAAGATAAGAGAAGATGG - Intergenic
1074607248 10:114985531-114985553 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1074691476 10:116008866-116008888 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074715231 10:116212121-116212143 ATGGTCAAAGTGTGTTAGAAAGG + Intronic
1075010128 10:118860792-118860814 ATGATTAAGTTGAGTGAGGTAGG + Intergenic
1075034716 10:119054798-119054820 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1075596523 10:123734270-123734292 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1075751218 10:124773073-124773095 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1076394786 10:130130555-130130577 ATGGTCATAGGGAGAGAGGATGG + Intergenic
1076734818 10:132453901-132453923 ATGGCTAAGCTGAGTGAGGCAGG + Intergenic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1078193648 11:9115752-9115774 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1078398931 11:11006912-11006934 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1079496966 11:21055705-21055727 ATGGCCAAGGTGGGAGAGGTGGG + Intronic
1079547883 11:21656939-21656961 ATGGTGAAAGTCAGTGAGGGAGG + Intergenic
1079954901 11:26850376-26850398 GTGGACATGGTGAGAGAGGAGGG - Intergenic
1080218765 11:29876060-29876082 ATCCTCAAAGGGAGTGAGGAAGG - Intergenic
1080603970 11:33848563-33848585 ATGATCCAGGTGAGAGATGATGG - Intergenic
1080842311 11:35996142-35996164 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
1081875203 11:46403833-46403855 AGGGCCAAGGGGAGTGGGGAGGG + Intronic
1082925271 11:58538658-58538680 AGGGTTACTGTGAGTGAGGACGG + Intronic
1083032715 11:59608470-59608492 ATGATCAACGTGAGTGCAGATGG - Exonic
1083040116 11:59677723-59677745 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1083071436 11:59987382-59987404 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1083235076 11:61345938-61345960 GCAGTCAAGGTGAGTGAGGCTGG + Exonic
1083878012 11:65534855-65534877 AGGGTCAAGTTTGGTGAGGATGG + Intronic
1084477533 11:69397372-69397394 ATGTTCCATGTGAGTGAGCAAGG - Intergenic
1085200688 11:74700014-74700036 ATGGCCAAGGTGTGCCAGGATGG - Intronic
1085582742 11:77669238-77669260 ATAGTCCAGGTGAGAGATGATGG - Intronic
1086034530 11:82400685-82400707 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086121633 11:83310830-83310852 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086479164 11:87215630-87215652 TTGGTCAAAGTGAGTGATAAGGG + Intronic
1086925371 11:92634472-92634494 ATTGTCCAGCTGAGTGAAGATGG - Intronic
1087156034 11:94904888-94904910 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1087341053 11:96907732-96907754 ATGGTCAAAAACAGTGAGGAAGG + Intergenic
1087818651 11:102687316-102687338 ATTGCCAAACTGAGTGAGGAAGG + Intergenic
1088182983 11:107133106-107133128 ATTTTTAAGGTGGGTGAGGAGGG + Intergenic
1088596027 11:111440881-111440903 GGGGACAAGGAGAGTGAGGAGGG + Intronic
1089823736 11:121252545-121252567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1090748984 11:129729575-129729597 ATGGTCCAGGTTTGGGAGGAAGG - Intergenic
1090813157 11:130265507-130265529 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1091496544 12:977960-977982 ATGATCAAGTTGAGTGAATATGG + Intronic
1091838465 12:3602520-3602542 GTGGCCAGGGTGCGTGAGGATGG - Intergenic
1091858354 12:3756855-3756877 GAGGTAAAGATGAGTGAGGATGG + Intronic
1092116760 12:6014425-6014447 ATAGTCCAGGTGAGAGATGATGG + Intronic
1092300061 12:7239317-7239339 ATGTTCATGGTGAGTGATAATGG - Intergenic
1092891202 12:12970881-12970903 ATGGTCAAGATGAGGAAGGGAGG - Intergenic
1093221881 12:16431396-16431418 ATGATTAAGTTCAGTGAGGAAGG - Intronic
1093427557 12:19045529-19045551 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1093450935 12:19312873-19312895 ATGATTAAGGTTAGTGAGGAAGG - Intronic
1093617170 12:21240321-21240343 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1094012256 12:25821622-25821644 ATATTCAAGGTAAGTGTGGAAGG - Intergenic
1094112507 12:26876543-26876565 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1094205369 12:27834026-27834048 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1095284743 12:40395553-40395575 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095435508 12:42183341-42183363 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1095518404 12:43033149-43033171 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095605972 12:44068375-44068397 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095657846 12:44691566-44691588 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1095688108 12:45058740-45058762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095975710 12:47939599-47939621 CTGGACTAGGTGAGTGAGGAGGG - Intronic
1096627889 12:52906476-52906498 ATTATCAAAGTGAGTCAGGAGGG + Intronic
1097154142 12:57000629-57000651 ATGGTCAGTGTGAGTAAGAAAGG + Exonic
1097266867 12:57751193-57751215 ACGATCAAGGTGAGTGGGGTTGG - Exonic
1097788554 12:63788881-63788903 ATAGTTAAGCTTAGTGAGGAAGG - Intronic
1097954745 12:65472122-65472144 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1098921761 12:76309032-76309054 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1098936739 12:76488862-76488884 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1100117480 12:91325004-91325026 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1100695616 12:97089572-97089594 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1101517255 12:105448257-105448279 ATTTTCAAGGTGAGTGATAATGG - Intergenic
1101934888 12:109049215-109049237 ATGATTAAGCTCAGTGAGGAAGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1103192928 12:119017749-119017771 AGGTTCAAAGTGAGTGAGGGAGG - Intronic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104534049 12:129601517-129601539 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1105547644 13:21362782-21362804 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1105833549 13:24187927-24187949 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1106504496 13:30359458-30359480 ATGGGCAATGTGAGTGATGATGG - Intergenic
1106879165 13:34110333-34110355 GTGGTCCTGGTGAGTGATGAGGG + Intergenic
1106987696 13:35374086-35374108 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1107010426 13:35665106-35665128 ATGGTCATGGCCTGTGAGGACGG - Exonic
1107287288 13:38808438-38808460 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1108070284 13:46621579-46621601 AAAGTCTAGGTGAGTCAGGAAGG + Intronic
1108181372 13:47843163-47843185 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1108274439 13:48793233-48793255 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1108602029 13:52003205-52003227 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1108678876 13:52762447-52762469 ATGGTGAAGTTGGGGGAGGAAGG + Intergenic
1109030418 13:57182220-57182242 ATGGTCATGCTAAGAGAGGAGGG + Intergenic
1109254684 13:60064804-60064826 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1109265840 13:60199357-60199379 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1109815616 13:67579313-67579335 ATGATTAAGTTTAGTGAGGATGG - Intergenic
1109853567 13:68100884-68100906 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1110447263 13:75599844-75599866 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1110735535 13:78931771-78931793 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1110812420 13:79825623-79825645 TGGTTCAAGGTGAGTGAGCAAGG - Intergenic
1110841477 13:80148455-80148477 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1111224124 13:85247048-85247070 ATGGTCCATATGGGTGAGGAAGG - Intergenic
1111839959 13:93437326-93437348 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1112208806 13:97352299-97352321 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1112728824 13:102336132-102336154 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1113137543 13:107110033-107110055 ATGGTTGAGTTTAGTGAGGAAGG - Intergenic
1113394558 13:109934512-109934534 ATGGTCTACTTGAGTGGGGAGGG - Intergenic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1113722664 13:112572174-112572196 ATGGTTAAGCTTGGTGAGGAAGG - Intronic
1114223750 14:20720036-20720058 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1114649760 14:24277051-24277073 GTGGGCATGGAGAGTGAGGATGG + Intergenic
1115172276 14:30522915-30522937 TTGGTCAAGAGGAGTGAGAATGG + Intergenic
1115709550 14:36035803-36035825 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116091678 14:40315712-40315734 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117201706 14:53396423-53396445 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117231259 14:53721207-53721229 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117392297 14:55273141-55273163 CAAGTCAAGGTCAGTGAGGAAGG - Intronic
1117519558 14:56537236-56537258 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1117586956 14:57217741-57217763 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1117725860 14:58672863-58672885 AAGGACAAAGTGAGTGAGAAGGG - Intergenic
1118518089 14:66548748-66548770 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1118560446 14:67074622-67074644 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118692985 14:68357868-68357890 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1119170583 14:72532523-72532545 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1119253573 14:73178988-73179010 ATTCCCAAGGTGAGTGAGTATGG - Intronic
1119264963 14:73259171-73259193 ATGGTCCAGGGGACGGAGGAAGG + Intronic
1119542516 14:75450083-75450105 ATGGACAAGGGGAGTTGGGAGGG + Intronic
1119883358 14:78119784-78119806 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1119940270 14:78633448-78633470 ATGTTGAAGGGGAGTGGGGAGGG - Intronic
1119984222 14:79117636-79117658 ATGGTGAGTGGGAGTGAGGAAGG + Intronic
1120821131 14:88912822-88912844 ATGATCCAGGTGAGAGACGATGG + Intergenic
1121170880 14:91853299-91853321 ATAATGAAGGTGAGAGAGGAAGG + Intronic
1121461480 14:94081975-94081997 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1121705082 14:95986538-95986560 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1122001392 14:98658244-98658266 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1122054528 14:99084537-99084559 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1122116083 14:99527911-99527933 CTGGGCAAGGTGCGTGAGAAGGG + Intronic
1122522735 14:102357054-102357076 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1124670795 15:31636595-31636617 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1125651986 15:41324834-41324856 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1125857861 15:42967811-42967833 CTGGTAAAGGTGACTGATGAGGG + Intronic
1125870593 15:43098002-43098024 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1126391713 15:48163010-48163032 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1126438981 15:48666644-48666666 GTGGTCCAGGTGATTGAAGATGG + Intergenic
1127447109 15:59074821-59074843 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1127948605 15:63781723-63781745 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1128629337 15:69247620-69247642 ATGATTAAGCTCAGTGAGGAGGG - Intronic
1128727607 15:69999485-69999507 CTGGTCAGGGTGAGGGAGGCGGG - Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1128806043 15:70532042-70532064 AAGGTCAAGGTTATTGAGGGAGG + Intergenic
1129126423 15:73445539-73445561 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1129186086 15:73907653-73907675 ATGGAACATGTGAGTGAGGATGG - Intergenic
1129499314 15:76020322-76020344 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1129948835 15:79567554-79567576 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1130301749 15:82684901-82684923 ATGGTTAGGCTTAGTGAGGAAGG - Intronic
1131175968 15:90210041-90210063 GTGGCCTAGGTGAGAGAGGATGG + Intronic
1131974142 15:97925844-97925866 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1132079589 15:98852768-98852790 ATGGCCACGGTGAGAGAGAAGGG - Intronic
1133449776 16:5894075-5894097 ATGGTGTGGGTGAGGGAGGAGGG + Intergenic
1135081265 16:19438023-19438045 TTGGTCCAGGTGATTCAGGAAGG - Intronic
1135827550 16:25742849-25742871 ATGGTCAAGGCTAGAGAGAAAGG - Intronic
1136118959 16:28116527-28116549 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1136682950 16:31978593-31978615 CTTGTCCAGGTGAGTGAGGGTGG + Intergenic
1136783589 16:32922149-32922171 CTTGTCCAGGTGAGTGAGGCTGG + Intergenic
1136886202 16:33931657-33931679 CTTGTCCAGGTGAGTGAGGGTGG - Intergenic
1137740400 16:50765578-50765600 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138073028 16:54012041-54012063 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138255456 16:55554731-55554753 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1138674434 16:58640860-58640882 ATGGTCCAGGCGAGAGATGATGG + Intergenic
1139650933 16:68361739-68361761 AGGGTCCTGGAGAGTGAGGAGGG - Exonic
1140157061 16:72441480-72441502 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1140574659 16:76152573-76152595 ATGATTAAGCTTAGTGAGGACGG - Intergenic
1140915179 16:79487012-79487034 GTGGTCGAGGTGAGAGAGGTTGG + Intergenic
1141304487 16:82848835-82848857 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1203086235 16_KI270728v1_random:1186143-1186165 CTTGTCCAGGTGAGTGAGGGTGG + Intergenic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143580247 17:7821403-7821425 ATGGTCAAGGTTGGGGATGAGGG + Intronic
1143648870 17:8250351-8250373 TTGGTCCAGGTGAGTGATGGTGG + Intronic
1143735034 17:8905626-8905648 ATGCTGGAGGTGAGGGAGGAGGG - Intronic
1144020697 17:11238870-11238892 GTGGTTAAGGTGTGTGAGCAGGG - Intergenic
1144165655 17:12607898-12607920 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1144706858 17:17374356-17374378 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1144992233 17:19241197-19241219 ATGATTAAGGTGGTTGAGGATGG + Intronic
1145277706 17:21444381-21444403 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145713972 17:27002197-27002219 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1146115483 17:30133982-30134004 ATGATTAAGCTGATTGAGGAAGG - Intronic
1146499762 17:33354346-33354368 CTGGTCCAGGTGAGAGATGAGGG - Intronic
1146578766 17:34017502-34017524 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1147143854 17:38474302-38474324 CTTGTCCAGGTGAGTGAGGCTGG + Intronic
1147589087 17:41669725-41669747 ATAGTCCAGGCGAGAGAGGATGG + Intergenic
1147659165 17:42107981-42108003 GTGGTGAAGCTGAGTGAGGCTGG - Exonic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148632215 17:49119941-49119963 AGGGTCCAGGTTAGTGAGAATGG - Intergenic
1150702653 17:67461178-67461200 ATGGACACAGTGAGTGTGGATGG - Intronic
1151001237 17:70379386-70379408 ATGGTGAAGGTCATTGAGGATGG + Intergenic
1151410776 17:73926780-73926802 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1152902539 17:82951648-82951670 ATGTTTAAGCTTAGTGAGGAAGG - Intronic
1152981462 18:281585-281607 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1153562671 18:6386959-6386981 GTGATCCAGGTGAGAGAGGATGG + Intronic
1153588791 18:6651417-6651439 AGGGGAAAGGAGAGTGAGGAAGG - Intergenic
1153859682 18:9188989-9189011 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1154022143 18:10673502-10673524 TAGGTGAAGGTGGGTGAGGAGGG + Intronic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155469978 18:26181529-26181551 ATTGTTAAGCTTAGTGAGGAAGG + Intronic
1155511911 18:26586547-26586569 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1155686223 18:28555143-28555165 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1155694300 18:28666329-28666351 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1155878920 18:31119575-31119597 ATGGTCCAGATGAGAGATGAGGG - Intergenic
1156042175 18:32835183-32835205 ATGCTCCAGGTGAGAGATGATGG + Intergenic
1156711567 18:39953160-39953182 ATGGTTAAACTTAGTGAGGAAGG - Intergenic
1157208116 18:45717847-45717869 GTGGGCCAGGGGAGTGAGGATGG - Intergenic
1157451735 18:47794202-47794224 ATAGTCATGGAGAGTGAGGTGGG + Intergenic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1157960458 18:52148190-52148212 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1159029477 18:63216316-63216338 AACGTCAAGGTGAGTCAGTAAGG + Intronic
1159096047 18:63903132-63903154 ATGGTGGATGTGAATGAGGAGGG + Exonic
1159388838 18:67761605-67761627 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1159408346 18:68036004-68036026 TAGGTCAATGAGAGTGAGGATGG + Intergenic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1160450505 18:78961011-78961033 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1160784015 19:891481-891503 CTGGCCCAGGTGAGTGATGATGG + Intronic
1161243276 19:3234831-3234853 CTGGTCCAGGTGAGGGATGAGGG - Intronic
1161451814 19:4350497-4350519 CTGGTCCAGGTGAGGGATGATGG + Intronic
1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG + Exonic
1162413712 19:10521272-10521294 AAGGGCAGGGGGAGTGAGGAGGG - Intergenic
1162641561 19:12014384-12014406 AGGGTAAAGGTGCCTGAGGAGGG - Intergenic
1162680127 19:12334141-12334163 AGAGGCAAGGTGAGAGAGGAAGG - Intergenic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162869693 19:13576138-13576160 TGGGACAAGGTGAGTGAGGTGGG - Intronic
1164061387 19:21678304-21678326 AGAGTCCAGGGGAGTGAGGAGGG + Intergenic
1165276368 19:34755449-34755471 GTGGTCACTGTGAGGGAGGATGG + Intergenic
1165461309 19:35945714-35945736 ATGGTAGAGGTGAGGCAGGAGGG + Exonic
1165798930 19:38536043-38536065 CTGGGCATGGTGAATGAGGATGG + Exonic
1165826710 19:38709772-38709794 AAGGGCAAGGTGGCTGAGGAGGG + Intronic
1166297672 19:41896940-41896962 AGGGGGAAGGTGAGAGAGGAGGG - Intronic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1166598921 19:44076396-44076418 ATGTTCAAGGTGAGTAAGTCTGG + Exonic
1167626850 19:50596063-50596085 ATGATTAAGTTCAGTGAGGAAGG + Intergenic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1202700624 1_KI270712v1_random:161148-161170 ATGGTCCAGGTGAGAGAGGCCGG + Intergenic
924989673 2:301832-301854 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925130731 2:1492487-1492509 ATGGACAAAGTGAAAGAGGAAGG - Intronic
925168568 2:1736247-1736269 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925360062 2:3272390-3272412 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925854074 2:8112661-8112683 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925871424 2:8274831-8274853 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
926387956 2:12356475-12356497 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
926537894 2:14136054-14136076 ATGGTCAAGTTTAGTGAGGAAGG + Intergenic
926649441 2:15325843-15325865 ATGATTAAGCTTAGTGAGGAAGG - Intronic
926753434 2:16217743-16217765 TTGGTCAAGGGGAGGGAGGGAGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926818525 2:16826612-16826634 ATGATTAAGATTAGTGAGGAAGG - Intergenic
926820651 2:16848101-16848123 ATGGTCAAGATGAAAGAGGTGGG + Intergenic
926895361 2:17681457-17681479 ATGATTAAGCTTAGTGAGGAAGG - Intronic
927396413 2:22656104-22656126 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
927657325 2:24960486-24960508 ATGATTAAGCTTAGTGAGGAAGG + Intronic
927946480 2:27137897-27137919 ACTGGCAAGGTGAGTGGGGAAGG + Exonic
928046156 2:27934564-27934586 ATGATGAAGTTTAGTGAGGAAGG + Intronic
928413703 2:31073859-31073881 ATGGTCCAAGTGAGAGAAGATGG + Intronic
928816412 2:35300156-35300178 AGGGACAATGAGAGTGAGGAGGG - Intergenic
929626979 2:43419322-43419344 ATGTTCAAAGTGAGTGAGGAAGG + Intronic
929866812 2:45724518-45724540 ATGATGAAGCTTAGTGAGGAAGG + Intronic
930471712 2:51824138-51824160 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
930948710 2:57110275-57110297 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
931050713 2:58411393-58411415 ATGATTAAGATTAGTGAGGAAGG + Intergenic
931425789 2:62169844-62169866 ATGATCAGAGTGAGTCAGGATGG - Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
931960981 2:67482591-67482613 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
932469932 2:71948121-71948143 ATGATCAAGATTAGTGAGGAAGG - Intergenic
932722590 2:74148470-74148492 ATGGTCCAGGTGAGAATGGAGGG + Intergenic
933328380 2:80867116-80867138 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
933873604 2:86595532-86595554 ATGATTAAGATTAGTGAGGAAGG + Intronic
933896839 2:86818800-86818822 ATGATTAAGTTTAGTGAGGAAGG + Intronic
933973438 2:87488910-87488932 ATGGTTAACATCAGTGAGGATGG + Intergenic
934171552 2:89544620-89544642 ATGGTCCAGGTGAGAGAGGCCGG + Intergenic
934281860 2:91618938-91618960 ATGGTCCAGGTGAGAGAGGCCGG + Intergenic
934548312 2:95237635-95237657 ATGATCAAGCTTAGTGAGGAAGG + Intronic
935460212 2:103322213-103322235 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
935608250 2:104992566-104992588 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
935990371 2:108713740-108713762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
936320286 2:111461303-111461325 ATGGTTAACATCAGTGAGGATGG - Intergenic
936365894 2:111854993-111855015 ATGATTAAGCTTAGTGAGGAAGG - Intronic
936409573 2:112244985-112245007 ATGATTAAGCTTAGTGAGGAAGG + Intronic
936603507 2:113924138-113924160 AGGGTCAAAGTGATTGTGGAGGG - Intronic
937109973 2:119358148-119358170 ATGATTAAGCTTAGTGAGGAAGG + Intronic
937174047 2:119908722-119908744 ATGATTAAGTTCAGTGAGGAAGG + Intronic
937461747 2:122094861-122094883 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
938022461 2:127917371-127917393 GTGATGAAGGTTAGTGAGGAAGG - Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938681961 2:133701291-133701313 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
938872002 2:135487974-135487996 ATGATCATGCTTAGTGAGGAAGG - Intronic
938905961 2:135836470-135836492 ATGGGGAAGGTGTGTGATGAAGG + Intronic
939718825 2:145621317-145621339 ATGGCCAAGGTAAGAGATGATGG - Intergenic
939786912 2:146525972-146525994 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
939994257 2:148905703-148905725 AGGGTCAAGGAGTGGGAGGATGG + Intronic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
941371302 2:164668283-164668305 ATGATCAAGTTTAGTGAGGAAGG - Intronic
941503740 2:166313815-166313837 ATGATTAAGCTTAGTGAGGAAGG - Intronic
941834636 2:170003164-170003186 ATAATCAAGATGAGTGAGGAAGG - Intronic
942258955 2:174138181-174138203 ATGATTAAGCTTAGTGAGGAAGG - Intronic
942847113 2:180440368-180440390 ATGATAAAGGTGAGAGATGATGG - Intergenic
942876875 2:180811065-180811087 ATGATCATGCTTAGTGAGGAAGG + Intergenic
943087416 2:183329390-183329412 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943251687 2:185529636-185529658 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
943420828 2:187667175-187667197 ATTATCAAGCTTAGTGAGGAAGG + Intergenic
943616545 2:190099225-190099247 ATGATCAAGCTTAGTGAGGAAGG - Intronic
943740815 2:191406427-191406449 ATGATTAAGCTTAGTGAGGAAGG - Intronic
943935468 2:193909797-193909819 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
946252789 2:218423764-218423786 TTGGTCATGGTGAGTGAGCCTGG - Exonic
946524236 2:220500853-220500875 ATGGTTAAGCCTAGTGAGGAAGG + Intergenic
946853169 2:223927769-223927791 ATGATTAAGCTTAGTGAGGAAGG - Intronic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947713047 2:232326650-232326672 AAGGTCAAGGGCACTGAGGAGGG - Intronic
947732730 2:232440106-232440128 AAGGTCAAGGGCACTGAGGAGGG - Intergenic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
947786322 2:232824256-232824278 ATGATTAAGCTTAGTGAGGAAGG + Intronic
948236119 2:236391962-236391984 AAGGACAAGGTGAGTGGGGAAGG - Exonic
948418406 2:237835390-237835412 ATGATTAAGCTTAGTGAGGAAGG + Intronic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
948962045 2:241346955-241346977 AAAGAAAAGGTGAGTGAGGATGG - Intronic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169032815 20:2424756-2424778 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1169050411 20:2572261-2572283 ATGGCCAAGGTGTGTGGGGTGGG + Exonic
1169104573 20:2983510-2983532 GTGATCCAGGTGAGAGAGGATGG + Intronic
1169198833 20:3697784-3697806 ATGGCCAGGGTGAGTCAGGCAGG - Exonic
1169235370 20:3925997-3926019 GTGGTCCAGGTGAGAAAGGAAGG + Intronic
1169432717 20:5553494-5553516 ATGATTAAGATTAGTGAGGAAGG + Intronic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1169760395 20:9086117-9086139 AAGGTCAAAGTGAGTGAGGCAGG - Intronic
1170174327 20:13451842-13451864 ATGATTAAGGTTAGTGAGGAAGG - Intronic
1170444308 20:16409586-16409608 GTGGTCCAGGTAAGTGATGATGG + Intronic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172981659 20:38947386-38947408 GTGTTGAGGGTGAGTGAGGATGG + Intronic
1173772514 20:45674527-45674549 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1173860062 20:46277565-46277587 ATGGTGAAGGTGAGTGAAAAGGG + Intronic
1174025696 20:47572501-47572523 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1175025563 20:55898856-55898878 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1175306750 20:57981485-57981507 CAGGGCAAGGTGAGTGAGGCGGG + Intergenic
1175476090 20:59275574-59275596 TGGGTCAAGGTGAGTGATGCTGG + Intergenic
1176946058 21:14983126-14983148 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1176951155 21:15047875-15047897 AAGGTTAAGCTCAGTGAGGAAGG - Intronic
1177461438 21:21416055-21416077 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1179395443 21:41036005-41036027 ATGATTAAGGTTAGAGAGGAAGG - Intergenic
1179429171 21:41307543-41307565 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1179965133 21:44799821-44799843 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1180113340 21:45677093-45677115 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1180590166 22:16930604-16930626 AAGGGCAAGGGGAGTGTGGATGG + Intergenic
1180870923 22:19146940-19146962 GTGGTCAAGGTGAGAGGTGACGG + Intergenic
1180932563 22:19603073-19603095 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1181009446 22:20031999-20032021 ATGGGCAAGGTGAGCCTGGAGGG - Intronic
1182734675 22:32523750-32523772 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1183306536 22:37085940-37085962 CAGGTCCAGGCGAGTGAGGAGGG + Intronic
1183681483 22:39332876-39332898 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1184818530 22:46890990-46891012 GTTGTCCAGGTGAGTGGGGAGGG + Intronic
1185110133 22:48896199-48896221 ACGGTGAGGGTGAGGGAGGAGGG + Intergenic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
949270206 3:2207323-2207345 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949438346 3:4053046-4053068 ATGATTAAGCTTAGTGAGGAAGG - Intronic
949728713 3:7081620-7081642 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949762891 3:7491571-7491593 ATTGACAAGGTGAGGGAGGTGGG + Intronic
949815206 3:8050882-8050904 ATGGTGAAGGAGGGTGGGGATGG + Intergenic
950112679 3:10429704-10429726 ATGATTAAGCTTAGTGAGGAAGG + Intronic
950259084 3:11531010-11531032 AGGACCACGGTGAGTGAGGAAGG - Intronic
950928127 3:16763635-16763657 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
950988879 3:17409495-17409517 ATGATTAAGCTTAGTGAGGAAGG + Intronic
951530056 3:23690371-23690393 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
951851811 3:27149804-27149826 ATGATAAAGCTTAGTGAGGAAGG + Intronic
952119420 3:30224176-30224198 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
952365478 3:32671119-32671141 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
952809980 3:37393243-37393265 ATGATTAAGCTTAGTGAGGAGGG + Intronic
952817154 3:37455548-37455570 CTCGTCAAAATGAGTGAGGAAGG + Intronic
952899916 3:38103639-38103661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
953174454 3:40537165-40537187 ATGATTAAGCTTAGTGAGGAAGG + Exonic
953367232 3:42355545-42355567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953436052 3:42878291-42878313 ATGATTAAGCTTAGTGAGGAAGG + Intronic
953483987 3:43277158-43277180 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953591973 3:44266431-44266453 ATGATTAAGCTTAGTGAGGAAGG - Intronic
953642291 3:44720308-44720330 CTTGTCCAGGTGAGTGAGCAAGG + Exonic
954183339 3:48898676-48898698 ACGGTCAAGGTGCGGGAGGCTGG - Exonic
954886918 3:53882709-53882731 ATGGTGAAAGTGAGAGGGGAGGG - Intergenic
955211174 3:56942652-56942674 ATGATTAAGCTTAGTGAGGAAGG + Intronic
955391609 3:58526276-58526298 GTGGTGGAGGTGAGAGAGGATGG + Intronic
955517880 3:59746121-59746143 ATAGTCAAGGTGATTGAGAAAGG - Intergenic
955976465 3:64485057-64485079 GTGGTCCAGGTGAGGGATGATGG - Intergenic
955981104 3:64528650-64528672 TTGGCCAAGGTGACTAAGGAAGG - Intronic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
956145083 3:66184006-66184028 AGGTTCAAGGTGAGTGTGAAAGG - Intronic
957360608 3:79151473-79151495 ATGGTCCAGGTGAGAGACGAGGG - Intronic
957707107 3:83803187-83803209 ATGATTAAGGTTAGTGAGAAAGG - Intergenic
957863711 3:85994577-85994599 ATGATGAAGCTTAGTGAGGAAGG - Intronic
957955733 3:87184761-87184783 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
958452128 3:94286560-94286582 ATGATTAAGGTTAGTGAGGAAGG + Intergenic
958492956 3:94801472-94801494 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
958530066 3:95316883-95316905 ATGATTAAGCTTAGTGAGGACGG - Intergenic
958900780 3:99884052-99884074 ATGGGCTAGGAGAGTGAGAATGG + Intronic
958933095 3:100228631-100228653 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959014333 3:101115701-101115723 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959044538 3:101458100-101458122 ATTGTCAAGGTGAATAAGGCAGG - Intronic
959413099 3:106049298-106049320 ATGATTAAGCTTAGTGAGGATGG + Intergenic
959821140 3:110736994-110737016 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
959873540 3:111355664-111355686 ATGATGAAGCTTAGTGAGGAAGG + Intronic
960179829 3:114562639-114562661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960549324 3:118956401-118956423 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960585703 3:119319767-119319789 ATGGTCAAGTTGTTAGAGGAAGG + Intronic
961092165 3:124122877-124122899 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961173178 3:124813657-124813679 CAGGGCAAGGTGTGTGAGGAGGG + Intronic
961411596 3:126726112-126726134 ATGATTAAGCTTAGTGAGGAAGG - Intronic
961826841 3:129603621-129603643 AAGGTCACGGTGGGTGAGCAGGG - Intronic
962455951 3:135565775-135565797 ACATTCAAGATGAGTGAGGAAGG - Intergenic
962962670 3:140325443-140325465 ATGGGCAAGGTGTTTGGGGAAGG - Intronic
963293209 3:143514985-143515007 ATGATTAAGCTTAGTGAGGAAGG - Intronic
963746736 3:149131731-149131753 ATGATTAAGCTTAGTGAGGAAGG + Intronic
964146614 3:153471704-153471726 ATGATGAAGATTAGTGAGGAAGG - Intergenic
964535024 3:157711412-157711434 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
964629156 3:158790798-158790820 ATGGTAGAGGTGGGTGGGGAAGG + Intronic
964823311 3:160797512-160797534 ATGATTAAGCTTAGTGAGGAAGG + Intronic
964930148 3:162009613-162009635 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
965276374 3:166688015-166688037 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
965595527 3:170406932-170406954 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
965599547 3:170441733-170441755 GTGGTGGAGGTGGGTGAGGAAGG - Intronic
966106114 3:176335930-176335952 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
966214310 3:177486262-177486284 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
966644707 3:182231522-182231544 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
966717412 3:183027371-183027393 ATGATTAAGTTTAGTGAGGAAGG + Intronic
967286038 3:187871513-187871535 AAGGTCAAGGTGTCTGAGTAGGG - Intergenic
967325816 3:188238454-188238476 ATGGTTAAGTTTAGTGAGGAAGG - Intronic
967766572 3:193286800-193286822 ATGGGTAAGCTTAGTGAGGAAGG + Intronic
967989675 3:195121576-195121598 ATGCTCAGTGTGACTGAGGAAGG - Intronic
968490711 4:889244-889266 ATGGTCAATCTGGGTGCGGAAGG + Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
969176095 4:5400168-5400190 GTGGCCAAGGTCTGTGAGGATGG - Intronic
970169450 4:13275222-13275244 ATGTTCAAGGTGAGAGATGCTGG - Intergenic
970528797 4:16960865-16960887 ATGATCAAGCTTAGTGAGGAAGG + Intergenic
970690056 4:18611849-18611871 AAGGTGAAAGGGAGTGAGGAAGG + Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
972669985 4:41206036-41206058 TTGGTCATGGTGACTGTGGAGGG - Intronic
972698324 4:41469446-41469468 CTTGTCAAAGTGAGAGAGGAAGG + Intronic
973223944 4:47761241-47761263 ATGATTAAGTTTAGTGAGGAAGG - Intronic
973262306 4:48177541-48177563 ATGGCCCAGGTGAATGAGGCAGG - Intronic
973396909 4:49602439-49602461 ATAATTAAGGTTAGTGAGGAAGG + Intergenic
973716669 4:53683662-53683684 AAGGACAATGTGAGTGTGGAAGG + Intronic
974397044 4:61350963-61350985 ATGATTAAGCTTAGTGAGGAAGG + Intronic
974522804 4:63007175-63007197 ATGATCAAGGTGAGAGATGATGG + Intergenic
974859300 4:67499793-67499815 ATGATTAAGCTTAGTGAGGAAGG - Intronic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975169698 4:71219138-71219160 ATGATTAAGCTTAGTGAGGAAGG + Intronic
976154481 4:82127830-82127852 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
977568063 4:98601808-98601830 ATGATTAAGCTTAGTGAGGAAGG - Intronic
977915753 4:102590826-102590848 ATGATTAAGCTTAGTGAGGAAGG + Intronic
978212110 4:106149365-106149387 ATGATTAAGCTTAGTGAGGAAGG - Intronic
979198031 4:117942982-117943004 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
979729430 4:124006246-124006268 ATGGTTAAGCTTGGTGAGGAAGG - Intergenic
980221331 4:129919783-129919805 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
980549702 4:134318622-134318644 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
980768114 4:137334976-137334998 ATGTTTAAGCTTAGTGAGGAAGG - Intergenic
981191381 4:141868837-141868859 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
981898401 4:149832852-149832874 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
982021731 4:151211487-151211509 ATGGTTAAGTTTAGTGAGGAAGG + Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982287476 4:153750078-153750100 AGGGTCAAGATGAGTGAACATGG + Intronic
982398168 4:154936649-154936671 CTGGTCAAGCTGAGTGGTGAAGG - Intergenic
982681710 4:158438914-158438936 ATGATCAAGTTTAGTGAGGAAGG + Intronic
982688710 4:158524244-158524266 ATGGTCTAGGGGAGAGAGCACGG - Intronic
983333129 4:166357188-166357210 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
983377222 4:166945631-166945653 GTGGTCAATTGGAGTGAGGAGGG - Intronic
983758207 4:171369138-171369160 ATGGTTAAGTGTAGTGAGGAAGG + Intergenic
983963260 4:173779541-173779563 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
984006273 4:174313774-174313796 AGGGTGAAGGAGAGTAAGGAAGG + Intronic
984038580 4:174700580-174700602 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
984258590 4:177416871-177416893 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984545117 4:181092338-181092360 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984637123 4:182123374-182123396 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984971737 4:185197803-185197825 ATGATTAAGCTTAGTGAGGAAGG + Intronic
985311092 4:188600293-188600315 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
985328340 4:188797762-188797784 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
985345886 4:189003599-189003621 ATTGTTAAGCTTAGTGAGGAAGG + Intergenic
985430261 4:189872412-189872434 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
985627806 5:999040-999062 AAGGTCAAGGTTGGTGGGGAAGG - Intergenic
985630616 5:1012108-1012130 ATGGTGAGGGTGAGTGTGCAGGG - Intronic
985964358 5:3328565-3328587 AAGGTCAAGGTGCGTGAGGTCGG - Intergenic
985967673 5:3349970-3349992 GTGTTCAAGGTGTGTGTGGAGGG - Intergenic
986408418 5:7450157-7450179 ATGATTAAGCTTAGTGAGGAAGG + Intronic
987668845 5:20982464-20982486 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
987726675 5:21709547-21709569 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
987791261 5:22571297-22571319 ATGATTAAGCTTAGTGAGGAAGG - Intronic
989654091 5:43725760-43725782 ATGATTAAGCTAAGTGAGGAAGG - Intergenic
990251781 5:53923185-53923207 TTGGTAAGGGTGAGTCAGGATGG + Intronic
992216732 5:74532128-74532150 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
992813437 5:80412154-80412176 ATGGTTAAGGTAAGAGATGAAGG - Intronic
992922255 5:81538049-81538071 ATGATCAAGCTCAGTGAGTAAGG + Intronic
993082149 5:83314972-83314994 ATGATTAAGCTTAGTGAGGAAGG + Intronic
993105336 5:83593722-83593744 AGCGTCAAGGGGAGTGGGGAGGG - Intergenic
993124317 5:83813860-83813882 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993709383 5:91209107-91209129 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993805736 5:92406803-92406825 ATGATTAAGCTTAGTGAGGAGGG + Intergenic
993897851 5:93559559-93559581 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993906434 5:93629018-93629040 ATGATTAAGCTTAGTGAGGAAGG - Intronic
994243142 5:97447809-97447831 GTGGCCTGGGTGAGTGAGGATGG - Intergenic
994431279 5:99664710-99664732 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
994562757 5:101397173-101397195 ACGTGCAAGGTGTGTGAGGAAGG + Intergenic
994996668 5:107072452-107072474 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
995505788 5:112859668-112859690 ATGATTAAGCTTAGTGAGGAAGG - Intronic
995615666 5:113960476-113960498 AAGGTCAAGGAGAGAGATGAGGG + Intergenic
995802131 5:116008461-116008483 ATGATTAAGTTTAGTGAGGAAGG + Intronic
995849316 5:116528387-116528409 ATTGTAAAGGCGAATGAGGATGG - Intronic
996067329 5:119093647-119093669 ATGATTAAGTTTAGTGAGGAGGG + Intronic
996209854 5:120794751-120794773 ATGGTTAAGTTTGGTGAGGAAGG + Intergenic
996512497 5:124332652-124332674 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996526369 5:124484445-124484467 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
996624521 5:125554081-125554103 AGGGTCATTGGGAGTGAGGATGG - Intergenic
996769113 5:127066952-127066974 ATTGTCAAGGAGACTGATGAGGG + Intronic
996807432 5:127472483-127472505 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996841952 5:127856590-127856612 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
997176230 5:131780908-131780930 ATGATCAAGCGTAGTGAGGAAGG + Intronic
997193711 5:131963309-131963331 AAGGTCAAGGAGAGTCAGGGAGG - Intronic
997404938 5:133638273-133638295 ATAGTCCTGGGGAGTGAGGAGGG - Intergenic
998719211 5:144924493-144924515 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
998730804 5:145074657-145074679 GTGGTCAAGGTGAGAAATGATGG + Intergenic
998831447 5:146163788-146163810 ATGATTAAGCTTAGTGAGGAAGG - Intronic
998872037 5:146561978-146562000 GTGGTTAAGGTGAGAGATGACGG + Intergenic
999275292 5:150325898-150325920 AGGGAAAAGGTGAGTGAGGCAGG - Intronic
999511883 5:152260756-152260778 ATGGGGAATGTGAGTGAGAATGG + Intergenic
999551535 5:152692788-152692810 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
999575868 5:152976024-152976046 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1000532318 5:162438527-162438549 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1000542513 5:162557843-162557865 ATGATCAAGCTTAGTCAGGAAGG - Intergenic
1000556226 5:162729422-162729444 ATGGTCCAGGTCAGAGATGATGG - Intergenic
1001405631 5:171475011-171475033 GTGGTCCAGGTGAGTGATGATGG - Intergenic
1001415987 5:171545173-171545195 AGGGTAATGGAGAGTGAGGAGGG + Intergenic
1001479770 5:172080398-172080420 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1001531279 5:172463588-172463610 ATGGTCCAGCTGAGAGATGATGG + Intergenic
1001655893 5:173349356-173349378 ATGATTAAGCTTAGTGAGGATGG + Intergenic
1001765377 5:174241882-174241904 AAGGTCAGGGGGAGGGAGGAAGG - Intronic
1002338321 5:178495650-178495672 CTGGTCAAGGAGAGTGGGAAGGG + Intronic
1002856839 6:1045391-1045413 ATGGTCAAGGGTGGTGAAGAGGG + Intergenic
1002881744 6:1258493-1258515 ATGATGAAGTTTAGTGAGGAAGG + Intergenic
1003111804 6:3257212-3257234 ATAGTCAAGGGGAGTGAGAGAGG + Intronic
1003404027 6:5813891-5813913 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1003598746 6:7499218-7499240 ATGGTGAAGCTTGGTGAGGAAGG - Intergenic
1003706102 6:8532169-8532191 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1003830928 6:10010630-10010652 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1004255498 6:14059817-14059839 ATGCACAAGGGGTGTGAGGAGGG + Intergenic
1004437483 6:15610518-15610540 ATAATCAAGCTTAGTGAGGAAGG + Intronic
1004551986 6:16656675-16656697 ATGGGCAAGGTGAAAGATGATGG - Intronic
1006510127 6:34516967-34516989 GGGGTCAAGGGCAGTGAGGAGGG - Intronic
1007251185 6:40496229-40496251 GTGGTCCAAGTGAGAGAGGATGG - Intronic
1007651021 6:43421859-43421881 ATGATCAAACTTAGTGAGGAAGG + Intergenic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1008255030 6:49287891-49287913 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1008622520 6:53285102-53285124 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1009461082 6:63914274-63914296 ATGATGAAGTTTAGTGAGGAAGG + Intronic
1009963313 6:70551275-70551297 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1010724578 6:79318809-79318831 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1011019803 6:82799822-82799844 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1011060697 6:83263371-83263393 ATGGTTAAGTTTAGTGAGAAAGG + Intronic
1011069804 6:83367923-83367945 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1011157627 6:84350669-84350691 AAGGTCAAGGTGAATGAGGCTGG + Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1011856504 6:91699505-91699527 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1012284482 6:97372315-97372337 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1012287661 6:97412675-97412697 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1012340055 6:98109751-98109773 ATGGGTAAGCTTAGTGAGGAAGG - Intergenic
1012928568 6:105293188-105293210 AGGGTTAAGCTCAGTGAGGAAGG - Intronic
1013261271 6:108445480-108445502 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1013381898 6:109581288-109581310 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1013551410 6:111211177-111211199 AGGGTCCAGGTGAGAGATGATGG + Intronic
1014262457 6:119235234-119235256 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1014729705 6:125018758-125018780 ATGGTCAAGAGAGGTGAGGAGGG - Intronic
1015009967 6:128333858-128333880 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1015144858 6:129974170-129974192 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1015259586 6:131221023-131221045 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1015337035 6:132051178-132051200 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
1015346624 6:132167760-132167782 ATTGTCAAGGTGAGACAGCAAGG + Intergenic
1015640744 6:135328731-135328753 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1015939744 6:138436176-138436198 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016794079 6:148099152-148099174 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
1016836398 6:148481476-148481498 ATGATTAAGCTTAGTGAGGAGGG - Intronic
1016848021 6:148588190-148588212 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016867409 6:148781118-148781140 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016903284 6:149123328-149123350 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016931573 6:149415879-149415901 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1017315455 6:153026071-153026093 AATGTCCAAGTGAGTGAGGAAGG - Intronic
1017355197 6:153496880-153496902 ATAGTCAAGCTTAGTGAGGAAGG + Intergenic
1017385003 6:153873217-153873239 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1017461017 6:154650499-154650521 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1017734692 6:157350623-157350645 ATGGTTAAGCTCAGTGAGGAAGG + Intergenic
1017900880 6:158717811-158717833 ATGGTCAGGGTGAGAGGTGAAGG - Intronic
1018294764 6:162333776-162333798 ATGATAAAGCTCAGTGAGGAAGG + Intronic
1018699585 6:166416084-166416106 ATGGTGGAGGTGATGGAGGAAGG - Intronic
1018699633 6:166416293-166416315 ATGGTAGAGGTGATGGAGGAGGG - Intronic
1019005259 6:168791128-168791150 ATGGTCAGGGTGAGTTCGCAGGG + Intergenic
1019061591 6:169261215-169261237 AAGGTCAATGTGTGTGATGAAGG - Intergenic
1019332331 7:466591-466613 AGGGTGAAGGAGAGTGAGGGAGG - Intergenic
1019599983 7:1876404-1876426 CTGGTCTCGGTGGGTGAGGACGG - Intronic
1020423824 7:8040998-8041020 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020649855 7:10861080-10861102 ATGGTGAAGGTCTGTGGGGAGGG - Intergenic
1020664563 7:11023936-11023958 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1021267960 7:18548002-18548024 ATGATTAAGCTGAGTTAGGAAGG - Intronic
1022066720 7:26865935-26865957 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022090439 7:27104425-27104447 ATGGTCAGGGAGAGAGAGGTTGG + Intergenic
1022144995 7:27528334-27528356 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1023461475 7:40402308-40402330 ATTGTCAAGATGAGTGAACAGGG + Intronic
1023724380 7:43127077-43127099 ATGATCAAGCTTAGTGAGGACGG + Intronic
1023773233 7:43579144-43579166 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024252300 7:47515581-47515603 ATGGTGATGGTGAGTGGTGATGG - Intronic
1024549327 7:50548301-50548323 ATGATTCAGCTGAGTGAGGAAGG + Intronic
1024786131 7:52910400-52910422 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1025943271 7:66088750-66088772 ATGGTCAGGCTGGGTGGGGATGG + Intronic
1026015389 7:66667459-66667481 AGGGACCAGGTGAGGGAGGAGGG - Intronic
1026206939 7:68265922-68265944 GTGGCCAAGATGAGTCAGGATGG - Intergenic
1026256103 7:68713213-68713235 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1026425909 7:70293454-70293476 ATGGTAAATGTGAGTGATAAAGG + Intronic
1026507741 7:71000206-71000228 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
1026891801 7:73986611-73986633 AGGGACCAGGTGAGGGAGGAGGG - Intergenic
1027006055 7:74693951-74693973 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1027289735 7:76693075-76693097 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027294178 7:76750049-76750071 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027490320 7:78815940-78815962 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1028712666 7:93927380-93927402 ATGCTCAAGGTGAGAAAGAAAGG - Exonic
1028847394 7:95497281-95497303 ATAGTCTAGGTGAGAGAAGATGG + Intronic
1029943040 7:104500606-104500628 ATGGTCCAGGTGAGAGGGAATGG - Intronic
1030022510 7:105289820-105289842 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1030136859 7:106260629-106260651 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030387330 7:108880223-108880245 ATAATTAAGCTGAGTGAGGAAGG + Intergenic
1031336375 7:120538492-120538514 ATGGTCATGGTGGGGCAGGAGGG + Intronic
1031432880 7:121694690-121694712 ATAGTCAAGATGAGTGATGATGG - Intergenic
1032701616 7:134385326-134385348 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1032730366 7:134636195-134636217 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1032769025 7:135029745-135029767 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1032778899 7:135146033-135146055 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1033112484 7:138593558-138593580 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1033393870 7:140955627-140955649 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1033584556 7:142764457-142764479 ATTTTCCAGGTGAATGAGGAGGG - Intergenic
1033855041 7:145550787-145550809 ATGGCCAGGGAAAGTGAGGATGG - Intergenic
1034438404 7:151074625-151074647 AGGGTTAAGGTGAATGTGGAGGG - Intronic
1034743314 7:153498368-153498390 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034743319 7:153498424-153498446 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034790056 7:153959900-153959922 ATGATTATGCTGAGTGAGGAAGG - Intronic
1034936204 7:155202571-155202593 ATGGTACAGGTGAGGGAGGGTGG + Intergenic
1035167096 7:156997939-156997961 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1036735688 8:11313507-11313529 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1037413373 8:18620678-18620700 ATGGCCTGGGTGAGTGAGCAAGG + Intronic
1037753757 8:21698600-21698622 ATGGTGCAGGTCAGGGAGGAAGG - Intronic
1038156409 8:24995109-24995131 ATGCTCAACATTAGTGAGGATGG - Intergenic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1039381980 8:37094005-37094027 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1039681148 8:39737748-39737770 ATAGTCAAGGAGAGTAACGACGG + Intergenic
1039983866 8:42431105-42431127 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1040033758 8:42849136-42849158 ATGATCAAGTGTAGTGAGGAAGG - Intergenic
1040562966 8:48540890-48540912 GTGGTCAAGGTGAGTGAGGCGGG + Intergenic
1041475994 8:58266556-58266578 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
1041822295 8:62050772-62050794 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1042045525 8:64646988-64647010 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1042158293 8:65867188-65867210 GAGGTCTAGGAGAGTGAGGACGG - Intergenic
1042408214 8:68430687-68430709 ATGGTCCTTGTGAATGAGGAAGG + Intronic
1042882397 8:73508216-73508238 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1043099024 8:76016341-76016363 ATGATTAAGCTGAGTGATGAAGG + Intergenic
1043965103 8:86465357-86465379 ATGGTCCAGGTAAGAGATGATGG + Intronic
1044547644 8:93477329-93477351 AGGGCCAAGGGGAGTGAGGTGGG - Intergenic
1044889491 8:96818018-96818040 ATGGTTAGGCTTAGTGAGGAAGG - Intronic
1045158320 8:99505339-99505361 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1045234884 8:100342812-100342834 GTGGTCCAGGTGAGAGATGATGG + Intronic
1046316780 8:112513262-112513284 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1046927660 8:119809548-119809570 ATGGTTAAGCTTAGGGAGGAAGG - Intronic
1047009882 8:120660730-120660752 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1047400663 8:124543931-124543953 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1047544546 8:125803057-125803079 ATGGCCATGGTGGGGGAGGATGG + Intergenic
1047630743 8:126705127-126705149 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1047794933 8:128245534-128245556 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1047799846 8:128297426-128297448 ATGGCCGAGGTGAATGAAGATGG - Intergenic
1048073884 8:131047864-131047886 ATCATCTAGGTGAGGGAGGATGG - Intergenic
1049739481 8:144230473-144230495 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1049760302 8:144329140-144329162 ATGGTCAGGGTAGGTGAGGTTGG + Intergenic
1049974949 9:852711-852733 AGGGTGAATGTGAGTGTGGATGG - Intronic
1050036431 9:1440567-1440589 AGGGTGAAGTTCAGTGAGGATGG - Intergenic
1050349578 9:4727777-4727799 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050383772 9:5061810-5061832 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050468377 9:5957919-5957941 ATGATCAAGTTGAGTGATAAGGG - Intronic
1050566675 9:6891151-6891173 ATGGTCTAGGTTAGGGATGAGGG + Intronic
1051009883 9:12398450-12398472 ATAGTTAAGGTTAGTGAGGTAGG + Intergenic
1051064420 9:13085183-13085205 ATGATTAGGCTGAGTGAGGAAGG + Intergenic
1051220461 9:14843295-14843317 ATGGGCAAGGGGAGTGGAGAGGG - Intronic
1051298258 9:15619244-15619266 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1051721638 9:20043111-20043133 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1053132545 9:35625103-35625125 AGGATTAAGGTTAGTGAGGAAGG + Intronic
1053250341 9:36568924-36568946 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1053296494 9:36918180-36918202 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1053465614 9:38305922-38305944 ATGATCAAGCTTAGTGAGGAAGG - Intergenic
1053575094 9:39351539-39351561 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053578955 9:39383112-39383134 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053839600 9:42179474-42179496 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053843467 9:42211187-42211209 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054096659 9:60910222-60910244 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054100538 9:60941916-60941938 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054118062 9:61185848-61185870 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054121934 9:61217541-61217563 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054585808 9:66964970-66964992 ATGATTGAGCTGAGTGAGGAAGG + Intergenic
1054589693 9:66996716-66996738 ATGATTAAGGTGAGTGAGGAAGG - Intergenic
1054839431 9:69720116-69720138 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1054986239 9:71264778-71264800 ATGCTTAAGGTGAGGGAGGGTGG - Intronic
1055039448 9:71853279-71853301 ATTGTTAAGCTTAGTGAGGAAGG - Intergenic
1055150690 9:72995406-72995428 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1055312564 9:74998200-74998222 ATGAACAAGGTGATTGGGGATGG - Intronic
1055557162 9:77486570-77486592 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1055985303 9:82053028-82053050 ATGGTCTTAGAGAGTGAGGAAGG + Intergenic
1056099540 9:83287578-83287600 ATGGTGAAGGTGAGGTAGAAAGG - Intronic
1056605433 9:88081223-88081245 TTGGTCCAGGTGGGAGAGGATGG + Intergenic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1056979265 9:91293268-91293290 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057370578 9:94469153-94469175 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1057539007 9:95947101-95947123 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1057823695 9:98354938-98354960 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1058057569 9:100464503-100464525 ATGGTCCACGTGAGTGAGGATGG - Intronic
1058628130 9:106957113-106957135 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059092984 9:111381139-111381161 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059158128 9:112007849-112007871 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1059328095 9:113516983-113517005 CTGGGCAAGGTGAGGGAGTAGGG + Intronic
1059329312 9:113524913-113524935 ATGGTCAAGGTGGGTGGTGTGGG + Intronic
1059711862 9:116875114-116875136 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1059917506 9:119119761-119119783 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1060066465 9:120505534-120505556 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1061121500 9:128645729-128645751 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1186395304 X:9202348-9202370 AAGCTCAAGCTTAGTGAGGAAGG + Intergenic
1186969852 X:14829957-14829979 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1187026669 X:15442499-15442521 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1187516629 X:19977252-19977274 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1187662912 X:21570600-21570622 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1187908787 X:24091380-24091402 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1188231091 X:27664103-27664125 ATGATCAAACTTAGTGAGGAAGG + Intronic
1188448232 X:30280125-30280147 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1189130368 X:38491890-38491912 ATGGGCATGGTGAGTGCTGAGGG + Intronic
1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG + Intronic
1189708638 X:43785607-43785629 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1189788029 X:44577193-44577215 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1189827790 X:44937768-44937790 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1190189494 X:48265315-48265337 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190324652 X:49199389-49199411 ATGGTGAAGGTGAGTCATAACGG + Intronic
1190460801 X:50671885-50671907 ATGCTTAAGCTTAGTGAGGAAGG - Intronic
1190658254 X:52631816-52631838 ATGGCTAAGCTTAGTGAGGAGGG - Intergenic
1190660187 X:52646834-52646856 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1190663396 X:52675978-52676000 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190676027 X:52782504-52782526 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1191881697 X:65849030-65849052 ATGGACAAGGCAAGTGGGGATGG - Intergenic
1191899616 X:66027300-66027322 ATGGTCAAGGGCACTGAGGATGG - Intronic
1194364727 X:93000843-93000865 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1195338748 X:103883608-103883630 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1197112678 X:122795292-122795314 AGGGTCAGGGAGAGGGAGGAGGG + Intergenic
1197114065 X:122811182-122811204 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1197129334 X:122986612-122986634 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1197456359 X:126680699-126680721 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198302642 X:135346278-135346300 ATGGTGGAGGGGAGTGGGGAAGG + Intronic
1198396163 X:136221277-136221299 ATTGTCTAGGTGAGTGATCAGGG - Intronic
1198542915 X:137659307-137659329 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1198621341 X:138514108-138514130 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198690349 X:139276623-139276645 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1199025080 X:142927097-142927119 CTGGGAAAGGTGAGTGGGGAAGG + Intergenic
1199343776 X:146714348-146714370 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1200088934 X:153625499-153625521 AGTGTGAAGGTGGGTGAGGAGGG + Intergenic
1200909069 Y:8515085-8515107 AGGGGCAACATGAGTGAGGATGG + Intergenic