ID: 1138443759

View in Genome Browser
Species Human (GRCh38)
Location 16:57050446-57050468
Sequence CCCCTCTCCGGGGCCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 192}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138443759_1138443771 21 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443771 16:57050490-57050512 GAAGGAACAGAAAGAGAGGAAGG 0: 1
1: 5
2: 69
3: 643
4: 4090
1138443759_1138443773 23 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443773 16:57050492-57050514 AGGAACAGAAAGAGAGGAAGGGG 0: 1
1: 1
2: 41
3: 388
4: 2987
1138443759_1138443767 -4 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443767 16:57050465-57050487 GGGGAGAGGGCAGCCTGCAGAGG 0: 1
1: 1
2: 13
3: 86
4: 789
1138443759_1138443772 22 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443772 16:57050491-57050513 AAGGAACAGAAAGAGAGGAAGGG 0: 1
1: 5
2: 41
3: 512
4: 3929
1138443759_1138443768 3 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443768 16:57050472-57050494 GGGCAGCCTGCAGAGGATGAAGG 0: 2
1: 1
2: 7
3: 47
4: 408
1138443759_1138443774 24 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443774 16:57050493-57050515 GGAACAGAAAGAGAGGAAGGGGG 0: 1
1: 1
2: 22
3: 288
4: 2488
1138443759_1138443770 17 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443770 16:57050486-57050508 GGATGAAGGAACAGAAAGAGAGG 0: 1
1: 0
2: 6
3: 135
4: 1060
1138443759_1138443775 27 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443775 16:57050496-57050518 ACAGAAAGAGAGGAAGGGGGAGG 0: 1
1: 3
2: 26
3: 364
4: 3008
1138443759_1138443776 30 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443776 16:57050499-57050521 GAAAGAGAGGAAGGGGGAGGTGG 0: 1
1: 4
2: 102
3: 1061
4: 6813

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138443759 Original CRISPR CCCCTCTCCGGGGCCTCCAA GGG (reversed) Intronic