ID: 1138443759

View in Genome Browser
Species Human (GRCh38)
Location 16:57050446-57050468
Sequence CCCCTCTCCGGGGCCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 192}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138443759_1138443775 27 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443775 16:57050496-57050518 ACAGAAAGAGAGGAAGGGGGAGG 0: 1
1: 3
2: 26
3: 364
4: 3008
1138443759_1138443773 23 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443773 16:57050492-57050514 AGGAACAGAAAGAGAGGAAGGGG 0: 1
1: 1
2: 41
3: 388
4: 2987
1138443759_1138443774 24 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443774 16:57050493-57050515 GGAACAGAAAGAGAGGAAGGGGG 0: 1
1: 1
2: 22
3: 288
4: 2488
1138443759_1138443767 -4 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443767 16:57050465-57050487 GGGGAGAGGGCAGCCTGCAGAGG 0: 1
1: 1
2: 13
3: 86
4: 789
1138443759_1138443770 17 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443770 16:57050486-57050508 GGATGAAGGAACAGAAAGAGAGG 0: 1
1: 0
2: 6
3: 135
4: 1060
1138443759_1138443776 30 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443776 16:57050499-57050521 GAAAGAGAGGAAGGGGGAGGTGG 0: 1
1: 4
2: 102
3: 1061
4: 6813
1138443759_1138443768 3 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443768 16:57050472-57050494 GGGCAGCCTGCAGAGGATGAAGG 0: 2
1: 1
2: 7
3: 47
4: 408
1138443759_1138443771 21 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443771 16:57050490-57050512 GAAGGAACAGAAAGAGAGGAAGG 0: 1
1: 5
2: 69
3: 643
4: 4090
1138443759_1138443772 22 Left 1138443759 16:57050446-57050468 CCCTTGGAGGCCCCGGAGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 192
Right 1138443772 16:57050491-57050513 AAGGAACAGAAAGAGAGGAAGGG 0: 1
1: 5
2: 41
3: 512
4: 3929

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138443759 Original CRISPR CCCCTCTCCGGGGCCTCCAA GGG (reversed) Intronic
900029513 1:360738-360760 CCTCCCACCTGGGCCTCCAAAGG + Intergenic
900050114 1:589509-589531 CCTCCCACCTGGGCCTCCAAAGG + Intergenic
900697945 1:4023958-4023980 ACTCTCTCCGGAGCCTCCAAGGG - Intergenic
902519040 1:17005445-17005467 CCCCCCACAGGGGCTTCCAACGG + Exonic
904018146 1:27440278-27440300 CCACTCTCCTTGGCCTCCCAAGG - Intronic
904828950 1:33294643-33294665 GCCCTCTCCGAGGCCTGCACTGG + Intronic
906248701 1:44294901-44294923 CCTCTCTGCGGAGCCTCCAGAGG - Intronic
906528537 1:46510439-46510461 CCCCTCTCCTTGCCCTCCAACGG + Intronic
907513619 1:54980126-54980148 TCCCTCTCCGGGGCCTCCACTGG + Intergenic
907542507 1:55228772-55228794 CCCCGCTCCTTGGCCTCCCAAGG + Intergenic
910463869 1:87475912-87475934 CCCCTCTCCATGCTCTCCAATGG + Intergenic
914753137 1:150549293-150549315 CCCCACCCCGGGGCCGCCGAGGG + Intergenic
916717258 1:167455957-167455979 CGTCTCTCCGGGGCTTCCCAAGG - Intronic
916943901 1:169704717-169704739 CCCAGCTCTGGGGCCTCCAAAGG + Exonic
919782663 1:201230901-201230923 CCACTGTCCCAGGCCTCCAAGGG - Intergenic
921642606 1:217573189-217573211 GCCCTCTCCGTACCCTCCAATGG + Intronic
922607972 1:226902672-226902694 TCCCTCTCTGAGGCCTGCAATGG + Intronic
923772772 1:236951870-236951892 CCCCTCTCCTGGGCTTGCAGAGG + Intergenic
923925004 1:238616446-238616468 CTTCACTCCAGGGCCTCCAATGG + Intergenic
1063146942 10:3303768-3303790 CCCCTCTCCGTGGCCTGTACAGG + Intergenic
1063448606 10:6136163-6136185 CCCCTCTCTGAGTCCCCCAAAGG - Intergenic
1070112755 10:73500592-73500614 ACCTTTTCAGGGGCCTCCAAGGG - Intronic
1070814489 10:79314170-79314192 CCACTCTCCAGGGCCTCCTGGGG + Exonic
1071563775 10:86661408-86661430 CCCCACACCTTGGCCTCCAAGGG + Intronic
1071904695 10:90159693-90159715 TCACTCTCTGGGGCCTCCTAAGG - Intergenic
1073041755 10:100612671-100612693 TTCCACTCCAGGGCCTCCAAGGG + Intergenic
1074760505 10:116664013-116664035 CCTCTCTCAGGGGCCTTCCAAGG + Exonic
1074974290 10:118567726-118567748 TCCCTCTCCAGGGCCCCCATGGG + Intergenic
1075728845 10:124624512-124624534 TCTCTCTCTGGGGCCTCAAAGGG - Intronic
1077543127 11:3157008-3157030 CCACTCCTCGGGGCCCCCAAGGG + Intronic
1078682189 11:13487314-13487336 CCCCTCTCTGGGGCTTGCCAAGG - Intergenic
1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG + Intronic
1080690451 11:34552793-34552815 ACCCTCACCGGGGCCAGCAAAGG - Intergenic
1082784286 11:57308512-57308534 CCCAGCTCCCTGGCCTCCAAGGG + Exonic
1084169169 11:67392217-67392239 CCCCTCACCCCGTCCTCCAAGGG - Exonic
1084463723 11:69310156-69310178 CCCCTATCCTGGTCCTCCATGGG + Intronic
1084541993 11:69792648-69792670 CCCCTCCCCTGGGACTACAATGG - Intergenic
1085084481 11:73657653-73657675 ACCCTCTCCAGGGCCTCCCAAGG + Intronic
1085320350 11:75570355-75570377 CCCCTCTCCAGGAACTCCCAGGG - Intronic
1086219287 11:84421916-84421938 CCCCTCTCCGAGGCCTCCTGTGG + Intronic
1088665190 11:112086945-112086967 CCCCTCACCTCGGCCTCCTAGGG - Exonic
1088764732 11:112963507-112963529 CTCCTCTCCGGGCCCTGCCACGG - Intronic
1089975385 11:122727561-122727583 CCCATCTCGGAGGCCTCCACGGG - Intronic
1095596131 12:43960274-43960296 CCCCTCTCCAGGGCCTCCCTGGG - Intronic
1096212594 12:49777983-49778005 CCCCTCTCCGCTGTCTCCAGTGG + Intergenic
1096716839 12:53496466-53496488 CCCTTCCCCGAGGCCTCCATGGG - Intronic
1097178304 12:57156355-57156377 CCCCTCTCTGGGCCCTCCTGTGG + Intronic
1103957053 12:124583006-124583028 CCCCTCTCAGGGCCCACCACTGG - Intergenic
1104658426 12:130591561-130591583 CCCCTCCCCGGAGCCTCTCAAGG - Intronic
1104785409 12:131445169-131445191 CCCCTCACCGGAGCCACCCAGGG + Intergenic
1104992485 12:132633985-132634007 CCCCTCTCCGGGCCCTCCAGTGG + Intronic
1106330337 13:28733691-28733713 CCCCTCACCTTGGCCTCCAAAGG + Intergenic
1110672705 13:78200244-78200266 CCCACCTCCAGGGCCTTCAAGGG - Intergenic
1113766962 13:112887819-112887841 CCCCTCTCCGGGTGCCCCAATGG - Intergenic
1113900877 13:113797225-113797247 CCCCTGGCCGGGGCCTCCCAGGG + Intronic
1113946935 13:114049755-114049777 CCCCTGCCAGGGGCCTCCAAGGG - Intronic
1114440157 14:22739759-22739781 CCCCTCTTGGGGGCCTGCCAGGG - Intergenic
1117530901 14:56659569-56659591 GGCCTCTCCGGAGCCTCCCAAGG - Intronic
1119415604 14:74467429-74467451 CCCCTCTCCTGGGGCTGAAAAGG - Intergenic
1121704489 14:95981514-95981536 CCCTTCTCCGGAGCCTGCACTGG - Intergenic
1121924131 14:97912617-97912639 CCCCTCTCTGGCCCTTCCAAAGG + Intergenic
1122575468 14:102739028-102739050 CTCCTCACCAGGGCATCCAAAGG - Intergenic
1123587644 15:21773388-21773410 CCCCCCACCTGGGCCTCCCAAGG - Intergenic
1123624282 15:22215953-22215975 CCCCCCACCTGGGCCTCCCAAGG - Intergenic
1123783496 15:23647265-23647287 TCCCCCTCCGGGGACCCCAATGG - Exonic
1124211715 15:27769975-27769997 CCCATCTCCTGGGTCTCCCAGGG + Intronic
1124220703 15:27847585-27847607 CCTCTCTCCGGGGCCTCTCCAGG - Intronic
1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG + Intronic
1128784419 15:70384223-70384245 CCCCGCTCCAGGCCCTGCAAGGG - Intergenic
1130302131 15:82688444-82688466 CCACTCTCCGGGGGCTCAAGTGG + Intronic
1131405483 15:92160843-92160865 CCATTCTGTGGGGCCTCCAAAGG - Intronic
1131432063 15:92395103-92395125 CCCCTCTCCGGAACCTCCAAAGG + Intronic
1132301624 15:100779647-100779669 TCCCTCTCTGAGGCCTCCTAAGG - Intergenic
1132809001 16:1788732-1788754 CCGCTTTCCAGGGCCACCAAGGG + Exonic
1132837999 16:1964397-1964419 CCGCTCTCCGGCGCCGCCCAGGG + Intronic
1132884899 16:2178367-2178389 CGCCTGGCCGGGGGCTCCAAGGG - Exonic
1135683315 16:24477560-24477582 CCTCCCTCCTGGGCCTCCCAAGG + Intergenic
1136601920 16:31297863-31297885 CTCCTCTCCTGGGGCCCCAATGG - Exonic
1137586086 16:49664650-49664672 CCCCACCCAGGGGCCTCCCAGGG - Intronic
1137767537 16:50989722-50989744 CCCCTCTCCGCAGGCTCAAAGGG + Intergenic
1138443759 16:57050446-57050468 CCCCTCTCCGGGGCCTCCAAGGG - Intronic
1138551992 16:57753284-57753306 TCCCTCTCCTGGGCCCCCGAAGG - Intronic
1140912521 16:79467134-79467156 CCCCTTACAGTGGCCTCCAAGGG + Intergenic
1141638620 16:85328813-85328835 CCCCGCCCCGGGGCCTCCCGCGG + Intergenic
1142156157 16:88533663-88533685 CTCTTCCCCGGGGCCCCCAAGGG + Exonic
1142377048 16:89711726-89711748 CCCCTCACCGGGCCCTCCCACGG + Intronic
1143016461 17:3893308-3893330 CCCTTCTCCTGGGCCTGCAGGGG + Intronic
1143382156 17:6503259-6503281 CCCCTCTCTGGGGACTCCACAGG - Intronic
1143654242 17:8284220-8284242 CCTCCCTCCTGGGCCTCCTACGG + Intergenic
1143749998 17:9021266-9021288 CCCCTCTCCGGGGTTTCCCCGGG + Intergenic
1145814408 17:27785132-27785154 CCCCACTCTGGGGCTTCGAAGGG + Intronic
1145979196 17:29001938-29001960 CCACTCTCTGGAGCCTTCAATGG - Intronic
1146398725 17:32487518-32487540 CTCCTCTCCGGGGCCGCCGCAGG + Exonic
1146957756 17:36946686-36946708 TCCCTCTCCCTGCCCTCCAAGGG - Intergenic
1148475977 17:47928986-47929008 CCCCTCTCCGAGCTCTCCAAGGG - Intergenic
1148855333 17:50576023-50576045 GCCCTCTCCGGGGCCCCCCCTGG + Exonic
1149491850 17:57090920-57090942 ACCATCTCCTGGCCCTCCAAAGG + Intronic
1151362540 17:73597186-73597208 CACCTCACCGGGGCCTTGAAGGG + Intronic
1151563945 17:74886738-74886760 CCCCTCTCCAGGGTCCCCATTGG + Intronic
1151975747 17:77482795-77482817 CAGCTCTCCGGGGCCACCAGGGG - Intronic
1152260118 17:79262289-79262311 CCCCTGTCCGGGGCCCCCCATGG - Intronic
1152377093 17:79924509-79924531 CCTTTCTGCAGGGCCTCCAAAGG + Intergenic
1152567558 17:81106974-81106996 CCCCTCAGCGGAGGCTCCAACGG - Intronic
1152766782 17:82145741-82145763 CCCCACTCAGGGGCCTGCAGGGG - Intronic
1152941288 17:83174006-83174028 CGCCTCGTCGGGGCCTCCAGGGG - Intergenic
1152950244 17:83225822-83225844 CCTCCCACCTGGGCCTCCAAAGG - Intergenic
1157757524 18:50231928-50231950 CCCCTCTCCTGGGCCAACACAGG + Intronic
1159625781 18:70692294-70692316 CTCCTCTCCAGCGCCTCCCAAGG + Intergenic
1160511365 18:79455409-79455431 CCCCTCTACGTGGCCTCCCGGGG + Intronic
1160709977 19:547031-547053 CCCCTCTCCAGGACCTCCCCAGG - Intronic
1161285453 19:3466100-3466122 ACCCTCGGCTGGGCCTCCAATGG - Intronic
1161455100 19:4366058-4366080 CCCCTGTCCGTGGCCTCCTATGG + Intronic
1163102729 19:15107756-15107778 GCCCCCTCCCGGGCCTCCCAAGG - Intronic
1164619972 19:29689585-29689607 CCCCTCTCCACAGCCTCCACAGG - Intergenic
1165065362 19:33225456-33225478 CCCCTCTCCGGGCGCTCGGACGG - Intronic
1165162682 19:33827046-33827068 GCTCTCTCAGGGGCCTCCAGTGG + Intergenic
1165524142 19:36338440-36338462 CCTCCCTCCTTGGCCTCCAAAGG - Exonic
1168340838 19:55622187-55622209 GCCCTCTCCGGGGCCACCCCGGG + Exonic
1168602319 19:57727675-57727697 CCCCTCTCCTGGGCCCTCATTGG + Intronic
932571154 2:72939053-72939075 CCTCTCTCTGGGTCCTCCATGGG + Intergenic
932615407 2:73228263-73228285 CCCTTCCCCAGGGCCCCCAAGGG - Exonic
932702481 2:74001247-74001269 CCCCTCCCCGGGGGCCCAAAGGG - Intronic
933892373 2:86783741-86783763 GCCCTCTCTGGAGCCTCCCAAGG + Intergenic
936190435 2:110333680-110333702 CTCCCCTACGGGGCCTCCTAAGG + Intergenic
939952443 2:148490961-148490983 CCACACTCCTGGACCTCCAAAGG - Intronic
942235072 2:173895961-173895983 CCCCTCTCCTGGTGCACCAAAGG + Intergenic
947712640 2:232324908-232324930 CCCCTCTCCTGGCCCTGCCATGG - Intronic
947815889 2:233036536-233036558 CCCCTCACCAGGGTCTCCAGAGG - Intergenic
948595353 2:239076152-239076174 CCACTCTCCTGGGCTTCCCAGGG + Intronic
948899490 2:240949188-240949210 CCCCTCTCCGGAGCCCACAGGGG + Intronic
1172005396 20:31815943-31815965 CCCCACCCCTGTGCCTCCAAGGG + Intergenic
1173645338 20:44629700-44629722 CCCCTCCCCTGAGCCTCCACCGG - Intronic
1174615544 20:51832624-51832646 TCCCTCTCCAAGGCCTCCAAAGG - Intergenic
1175256339 20:57649789-57649811 CCCCTCCCAGGGTCCACCAAGGG - Exonic
1175267041 20:57709434-57709456 CCCCTCCCCGGAGACTCCATCGG - Intronic
1175482417 20:59320952-59320974 CCCTGCTCAGGGGCCCCCAAGGG - Intronic
1175720049 20:61280365-61280387 TCCCTCTCTGGCGCCTCCCAAGG + Intronic
1176111447 20:63412627-63412649 CCCAACTCCGGGCCCTCCAGTGG - Intronic
1178265380 21:31138040-31138062 CCTCTCTCTGGGGCTTCCACTGG + Intronic
1178922843 21:36750323-36750345 GCCCTCCACGGGGCCTCCCAGGG + Intergenic
1179407568 21:41138054-41138076 CCCCACTCAGTGCCCTCCAACGG + Intergenic
1183516522 22:38270050-38270072 CTCCTTGGCGGGGCCTCCAAAGG + Intronic
1184251535 22:43263200-43263222 CCCCTCTCCCGAGCCACCCATGG + Intronic
1184727787 22:46356579-46356601 GGCCTCTCCTGGGACTCCAAGGG - Intronic
1185266933 22:49909174-49909196 CACATCTCCTGGGCCTCCATGGG - Intronic
1185413577 22:50698062-50698084 CACATCGCAGGGGCCTCCAATGG - Intergenic
949275167 3:2270764-2270786 CCCCTCTCAGGACCCTCCAAAGG - Intronic
949877423 3:8635339-8635361 GGCCTCCCTGGGGCCTCCAAAGG + Exonic
952768623 3:36977014-36977036 CCCTTCCCCAGGGCCCCCAAGGG + Intergenic
954461112 3:50627589-50627611 CCCCTCTCCTGGGCCTGCCTAGG - Intronic
956872344 3:73430519-73430541 CCCCTCTTCCTGGCCTCCATTGG + Intronic
957227305 3:77466491-77466513 CCCCTATCTAGGACCTCCAATGG + Intronic
962198128 3:133380515-133380537 CACCTCCCTGGGGCCTGCAAAGG + Exonic
965360554 3:167734515-167734537 CCCCTCTCCCGGGGCACCAGGGG + Intronic
967894318 3:194384282-194384304 CACCTCACAGGGCCCTCCAATGG + Intergenic
972666202 4:41167460-41167482 CACCACTCAGGGGACTCCAAGGG + Intronic
973286269 4:48420258-48420280 CTCCTCACCTGGGCCTCCTATGG + Exonic
975801886 4:78068566-78068588 CTCCTCTCTGGCACCTCCAATGG - Intronic
982213753 4:153062712-153062734 CCCCCCTCCCGGGCCTCAGAAGG + Intergenic
982454616 4:155594149-155594171 CCCCTCTCCTTCGCCTTCAACGG - Intergenic
986179956 5:5384272-5384294 CCCTCCTCAGGGCCCTCCAATGG - Intergenic
987234758 5:15931515-15931537 CCCATCTCCATGGCCTCCAGAGG + Intronic
990380836 5:55220915-55220937 CTCCTCTCCCGGGCCCCCACGGG + Intronic
992039561 5:72816670-72816692 CTCCTGTCCGGGGCCTGAAATGG - Exonic
992446476 5:76838797-76838819 GTCCTCTCAGGGGCCTCCAAAGG - Intergenic
993727095 5:91380847-91380869 CCCCTCTTTTGGGCCTCCTAAGG - Intronic
996329374 5:122312102-122312124 CCGCTCCCCGGGCCCCCCAACGG - Exonic
997212185 5:132083331-132083353 CCCCTCTCTGGGTCCTCTAAAGG + Intergenic
997605476 5:135172976-135172998 CCCTTCTCCATGGTCTCCAAGGG - Intronic
998020048 5:138761862-138761884 CCCCTCACCGCAGCCTCCTATGG + Intronic
998691712 5:144595073-144595095 CCCCTCTCCGGGGCTGGCCAAGG + Intergenic
999395442 5:151224000-151224022 CCCAACTCCGGGGCCCCCAGAGG + Exonic
1001102358 5:168824792-168824814 ACCCTCTCCTGAGCCTCCATGGG + Intronic
1001796880 5:174509733-174509755 CCCCGCTCAGAGGCCTCCCATGG - Intergenic
1002103596 5:176869245-176869267 CCCCACTCCTGAGTCTCCAAGGG + Intronic
1002308256 5:178296972-178296994 CCCCTTTCCAGGGCTTCCCACGG + Intronic
1002744477 5:181459634-181459656 CCTCCCACCTGGGCCTCCAAAGG - Intergenic
1005959512 6:30685651-30685673 CTCCGCTCCCGGGCCTCCAGAGG + Exonic
1006380382 6:33693842-33693864 CCCCTCTGCCTGGCCTCCTAGGG - Intronic
1007375050 6:41450903-41450925 CCCCTCTTTGGGGCCTACACAGG + Intergenic
1008375616 6:50787796-50787818 CCCTTCTCAGGGGCCTCCTCAGG - Intergenic
1008862221 6:56162591-56162613 ACCATCTCCAGGGTCTCCAAGGG - Intronic
1009437611 6:63636044-63636066 CCCCTCTCCGCGGCACCCACCGG + Exonic
1016994919 6:149954760-149954782 ACCCACTCCGGGGTCTCCACAGG + Intergenic
1017003690 6:150014676-150014698 ACCCACTCCGGGGTCTCCACAGG - Intergenic
1017989463 6:159473502-159473524 TCCCTCTCCAGGGCCTCATATGG - Intergenic
1019249388 6:170733175-170733197 CCTCCCACCTGGGCCTCCAAAGG - Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019505416 7:1388119-1388141 CTGCTCTCCGGAGCCTCCGAGGG - Intergenic
1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG + Intronic
1023623632 7:42095990-42096012 CACCAGTCAGGGGCCTCCAAGGG + Intronic
1029435660 7:100562693-100562715 CCCCTCCCCTGGGTCTCCACAGG - Intronic
1031923833 7:127620081-127620103 CCCCTCTCCGGGGCCAGCCATGG + Intergenic
1033601167 7:142889210-142889232 CCCCTCTCAGGGGCCGTCAGAGG - Intergenic
1035498709 8:74472-74494 CCTCCCACCTGGGCCTCCAAAGG + Intronic
1036768295 8:11562858-11562880 CCCCACTGCGGGGCCTCACAGGG - Intronic
1037336968 8:17801261-17801283 CCCGCCTCCGGGGCCGCCAGGGG + Intergenic
1040946334 8:52888765-52888787 TCCATCTTCCGGGCCTCCAAAGG - Intergenic
1045343255 8:101272722-101272744 CCTCCCTCAGGGGCCTCCAAGGG + Intergenic
1045642717 8:104269676-104269698 CCCCTCTCCTGGGACCCCTAAGG - Intergenic
1046289436 8:112137549-112137571 CCCCTCTCCTAGGCCTTCAGAGG + Intergenic
1047111486 8:121794084-121794106 CTCCTCTCTGGGGCCTCAGAGGG - Intergenic
1049180701 8:141220645-141220667 CCCTTCTCCCGCGCCTCCCACGG - Intronic
1049334117 8:142073427-142073449 ACCACCACCGGGGCCTCCAAAGG + Intergenic
1050850628 9:10280856-10280878 CCTCTCTCCTAGGCCTCCCAAGG + Intronic
1052816779 9:33107773-33107795 CCCCTCCCCATGGGCTCCAAGGG - Intronic
1059336045 9:113569063-113569085 CCCCTCTCCCTGCCCTCCATGGG + Intronic
1062288867 9:135785745-135785767 CCCAGGTTCGGGGCCTCCAAAGG + Intronic
1062299025 9:135853796-135853818 CGCTTCTCCTGGGCCTTCAATGG + Intronic
1062514710 9:136926838-136926860 CTCCTCTCCTGGGCCTCCCCAGG + Intronic
1203610288 Un_KI270748v1:90128-90150 CCTCCCACCTGGGCCTCCAAAGG - Intergenic
1188009811 X:25043665-25043687 CACCTCTCAGGGGCAGCCAAGGG + Intergenic
1192670569 X:73136069-73136091 CCCTTCTCCTGTGCCTCCATGGG + Intergenic
1197707730 X:129646561-129646583 CCCCTCTCCGCCTCCCCCAAAGG + Exonic
1198394414 X:136207704-136207726 CCCCTCCCCAGGCCCTCCAGAGG - Intronic
1199610722 X:149610740-149610762 CCCCTCTCCCCTGCCCCCAAAGG + Intronic
1199628360 X:149760198-149760220 CCCCTACCTGGGGCCTCCAGGGG - Intergenic
1200212825 X:154354470-154354492 GGCCTCTCCGGGGCCTGCAGTGG + Exonic