ID: 1138445691

View in Genome Browser
Species Human (GRCh38)
Location 16:57061708-57061730
Sequence CCTCCCGGAGGCAGCGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 480}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138445691_1138445710 13 Left 1138445691 16:57061708-57061730 CCTCCCCCGCTGCCTCCGGGAGG 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1138445710 16:57061744-57061766 ATGGGAGCAGGGGTGGGCACTGG 0: 1
1: 0
2: 5
3: 64
4: 683
1138445691_1138445711 22 Left 1138445691 16:57061708-57061730 CCTCCCCCGCTGCCTCCGGGAGG 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1138445711 16:57061753-57061775 GGGGTGGGCACTGGAGTAAGAGG 0: 1
1: 0
2: 5
3: 39
4: 380
1138445691_1138445706 2 Left 1138445691 16:57061708-57061730 CCTCCCCCGCTGCCTCCGGGAGG 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1138445706 16:57061733-57061755 CCATGGCATGAATGGGAGCAGGG 0: 1
1: 0
2: 1
3: 30
4: 251
1138445691_1138445712 30 Left 1138445691 16:57061708-57061730 CCTCCCCCGCTGCCTCCGGGAGG 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1138445712 16:57061761-57061783 CACTGGAGTAAGAGGCCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 140
1138445691_1138445703 -5 Left 1138445691 16:57061708-57061730 CCTCCCCCGCTGCCTCCGGGAGG 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1138445703 16:57061726-57061748 GGAGGGGCCATGGCATGAATGGG 0: 1
1: 0
2: 0
3: 21
4: 208
1138445691_1138445702 -6 Left 1138445691 16:57061708-57061730 CCTCCCCCGCTGCCTCCGGGAGG 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1138445702 16:57061725-57061747 GGGAGGGGCCATGGCATGAATGG 0: 1
1: 0
2: 0
3: 43
4: 380
1138445691_1138445707 3 Left 1138445691 16:57061708-57061730 CCTCCCCCGCTGCCTCCGGGAGG 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1138445707 16:57061734-57061756 CATGGCATGAATGGGAGCAGGGG 0: 1
1: 0
2: 1
3: 49
4: 332
1138445691_1138445709 7 Left 1138445691 16:57061708-57061730 CCTCCCCCGCTGCCTCCGGGAGG 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1138445709 16:57061738-57061760 GCATGAATGGGAGCAGGGGTGGG 0: 1
1: 0
2: 4
3: 47
4: 462
1138445691_1138445708 6 Left 1138445691 16:57061708-57061730 CCTCCCCCGCTGCCTCCGGGAGG 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1138445708 16:57061737-57061759 GGCATGAATGGGAGCAGGGGTGG 0: 1
1: 0
2: 2
3: 44
4: 495
1138445691_1138445704 1 Left 1138445691 16:57061708-57061730 CCTCCCCCGCTGCCTCCGGGAGG 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1138445704 16:57061732-57061754 GCCATGGCATGAATGGGAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138445691 Original CRISPR CCTCCCGGAGGCAGCGGGGG AGG (reversed) Intronic