ID: 1138448470

View in Genome Browser
Species Human (GRCh38)
Location 16:57079059-57079081
Sequence CAGCCATCTGGGCCCAGGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 338}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138448459_1138448470 -1 Left 1138448459 16:57079037-57079059 CCTCTTTCCCCAGCCTACCATTC 0: 1
1: 0
2: 3
3: 57
4: 647
Right 1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG 0: 1
1: 0
2: 1
3: 34
4: 338
1138448453_1138448470 27 Left 1138448453 16:57079009-57079031 CCAGTCCCTCAGGCTCCTCTCAC 0: 1
1: 0
2: 2
3: 34
4: 462
Right 1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG 0: 1
1: 0
2: 1
3: 34
4: 338
1138448456_1138448470 12 Left 1138448456 16:57079024-57079046 CCTCTCACCCTCTCCTCTTTCCC 0: 1
1: 1
2: 31
3: 297
4: 2275
Right 1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG 0: 1
1: 0
2: 1
3: 34
4: 338
1138448461_1138448470 -9 Left 1138448461 16:57079045-57079067 CCCAGCCTACCATTCAGCCATCT 0: 1
1: 0
2: 1
3: 21
4: 270
Right 1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG 0: 1
1: 0
2: 1
3: 34
4: 338
1138448455_1138448470 21 Left 1138448455 16:57079015-57079037 CCTCAGGCTCCTCTCACCCTCTC 0: 1
1: 0
2: 13
3: 125
4: 1016
Right 1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG 0: 1
1: 0
2: 1
3: 34
4: 338
1138448454_1138448470 22 Left 1138448454 16:57079014-57079036 CCCTCAGGCTCCTCTCACCCTCT 0: 1
1: 0
2: 6
3: 83
4: 650
Right 1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG 0: 1
1: 0
2: 1
3: 34
4: 338
1138448457_1138448470 5 Left 1138448457 16:57079031-57079053 CCCTCTCCTCTTTCCCCAGCCTA 0: 1
1: 0
2: 9
3: 97
4: 1104
Right 1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG 0: 1
1: 0
2: 1
3: 34
4: 338
1138448460_1138448470 -8 Left 1138448460 16:57079044-57079066 CCCCAGCCTACCATTCAGCCATC 0: 1
1: 0
2: 0
3: 14
4: 287
Right 1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG 0: 1
1: 0
2: 1
3: 34
4: 338
1138448462_1138448470 -10 Left 1138448462 16:57079046-57079068 CCAGCCTACCATTCAGCCATCTG 0: 1
1: 0
2: 2
3: 24
4: 243
Right 1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG 0: 1
1: 0
2: 1
3: 34
4: 338
1138448458_1138448470 4 Left 1138448458 16:57079032-57079054 CCTCTCCTCTTTCCCCAGCCTAC 0: 1
1: 0
2: 3
3: 81
4: 1036
Right 1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG 0: 1
1: 0
2: 1
3: 34
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138448470 Original CRISPR CAGCCATCTGGGCCCAGGTG GGG Exonic
900290441 1:1921505-1921527 CACCCAGCAGGGGCCAGGTGAGG - Intergenic
900624342 1:3601214-3601236 AAGCCATCTGAGCCCAGGGCTGG - Intronic
900643132 1:3696781-3696803 AAGCCATGTGGGGCCAGGGGAGG + Intronic
901090198 1:6635791-6635813 CAGCTGGCTGGGCCCAGGCGAGG + Intronic
901216543 1:7558431-7558453 CAGCTGTCTGGGCCCTGCTGGGG - Intronic
902048961 1:13546872-13546894 TAGCCACCTGGCCACAGGTGGGG + Intergenic
902868408 1:19296520-19296542 AAGCCATTTGTGGCCAGGTGCGG - Intergenic
903138708 1:21326041-21326063 CACCCCACTGGGTCCAGGTGAGG - Intronic
903329288 1:22588939-22588961 CGGCCACCTGGGTCCAGGGGAGG - Exonic
903428143 1:23270153-23270175 CAGGCATCTTTGGCCAGGTGCGG - Intergenic
904841600 1:33375401-33375423 CAGAAATCTGGGGCCCGGTGGGG + Exonic
905224893 1:36472511-36472533 AAGCCAGCTGGGCACTGGTGAGG - Exonic
907308145 1:53525013-53525035 CAGCCAGCCCGGCCCAGCTGTGG + Intronic
909223417 1:72989645-72989667 CAGTCATGTGGGGTCAGGTGTGG + Intergenic
913243654 1:116852446-116852468 GAGCCATCTTGGCCCAGTTCAGG - Intergenic
913327315 1:117638231-117638253 CAGCCTTCTAGCCTCAGGTGAGG + Intergenic
914750849 1:150534076-150534098 CAGCCTTCTGGGCCAGGGTGGGG + Intergenic
914871632 1:151479871-151479893 TAGCAATCTGGGGCCAGGCGCGG + Intergenic
914881547 1:151550633-151550655 AAGCAAGCTGGGGCCAGGTGTGG - Intronic
915162534 1:153930486-153930508 TAGGGATCTGGGGCCAGGTGTGG - Intronic
915444901 1:155969026-155969048 CTGGCATTTGGGCCCAGCTGGGG + Intronic
916046252 1:161001973-161001995 CACACAGCTGGGGCCAGGTGCGG + Intronic
916485655 1:165256214-165256236 CAGCCATCCTGCCCTAGGTGAGG + Intronic
917486657 1:175461116-175461138 CATCCATCTGGGACCAGGAAGGG - Intronic
919751626 1:201041357-201041379 CAGTCATCTGGGCCCTGGAATGG - Intronic
920576484 1:207064656-207064678 GAGCCATCTGGTCCCAAGTCAGG + Intronic
920982374 1:210850206-210850228 AAAACATCTGGGGCCAGGTGCGG + Intronic
922817320 1:228459149-228459171 AAGACATTTGGGGCCAGGTGCGG - Exonic
923306817 1:232696173-232696195 CAGCCAGATTGCCCCAGGTGGGG + Intergenic
1062909942 10:1205864-1205886 CAGCCCGCTGCGGCCAGGTGGGG + Intronic
1062909966 10:1205927-1205949 CAGCCCGCTGGGGTCAGGTGGGG + Intronic
1064031831 10:11887590-11887612 AAGGCATCAGGGCCCAAGTGAGG + Intergenic
1066401478 10:35080921-35080943 AAGCCATTTGCACCCAGGTGTGG + Intronic
1067181861 10:43993177-43993199 CGGCCATCTTAGCTCAGGTGAGG + Intergenic
1067534055 10:47095210-47095232 AAGCCTTCTGTTCCCAGGTGAGG + Intergenic
1068841224 10:61616490-61616512 CAGCCAGCTGGGCTTAGGGGTGG - Intergenic
1069774711 10:70919617-70919639 CAGCCCTCTGGGCCTGGGGGAGG + Intergenic
1069777026 10:70933247-70933269 GAGTCACCTGGGCCCAGGTATGG + Intergenic
1069830908 10:71281960-71281982 CAGCCATCGGGGTCCAGGCAAGG + Intronic
1070546061 10:77453616-77453638 GAGACATCTGGGCCCTGCTGGGG - Intronic
1070664898 10:78336072-78336094 CACCCATCTGGGTGCAGGTCAGG + Intergenic
1072615462 10:97046544-97046566 CTGCAAGCTGGGCCCAGGGGAGG + Intronic
1073483678 10:103802930-103802952 CAGGGATCTGGGCCAAGATGAGG + Intronic
1073767487 10:106699162-106699184 CAGCCAGCTGGGCACTGCTGTGG + Intronic
1074160912 10:110835752-110835774 CTGGCATCTGTGCCCAGCTGTGG - Intronic
1074361086 10:112824580-112824602 CAGCCATCTGGACCCAGAAGTGG - Intergenic
1074452601 10:113571392-113571414 CAGTCATGTGGGTCCAGGAGTGG + Intronic
1074967145 10:118501307-118501329 CTGGCTGCTGGGCCCAGGTGAGG + Intergenic
1075290786 10:121228841-121228863 CAGCCAAGTGGGCTCAGGTGTGG - Intergenic
1076372895 10:129966575-129966597 CAGCCATCTGGCCCGAAATGGGG + Intergenic
1076414183 10:130273500-130273522 CAGCCACCTGGGCACTGCTGTGG + Intergenic
1076525907 10:131112330-131112352 GGGGCATCTGGGCCCAGGAGGGG - Intronic
1076931454 10:133534483-133534505 CACCCATCTGGGCCAAGTAGAGG + Intronic
1077170714 11:1164725-1164747 CAGCCTTAGGGGCCCAGGAGAGG - Intronic
1078513902 11:12007435-12007457 CAGCCCTCTCTGTCCAGGTGCGG - Intronic
1079297983 11:19251597-19251619 CAGCCATCTTAGGCCAGGAGTGG - Intergenic
1082792015 11:57352717-57352739 CATCCTTCTGTGCTCAGGTGGGG - Intronic
1083776028 11:64894721-64894743 CAGCAGTGTGGGCCCAGGTCGGG + Exonic
1083943023 11:65908206-65908228 GAGCCATCTGTGCAAAGGTGAGG - Intergenic
1084012722 11:66361666-66361688 CATCCCTCAGGGCCCAGCTGGGG + Intronic
1084457840 11:69278609-69278631 CAGCCACCAGAGCCCAAGTGAGG + Intergenic
1088870513 11:113886493-113886515 AAGGCTTCTGGGGCCAGGTGCGG - Intergenic
1090391864 11:126394095-126394117 CAGGCATCTGGGGTCAGGGGAGG + Intronic
1090611056 11:128471198-128471220 CAGCCATCAGGGCCCAAGACAGG + Intronic
1092030018 12:5276166-5276188 CAGGCATTTGGGTCCAGGTTGGG + Intergenic
1092752220 12:11729402-11729424 CAGCCATGTGGGATCAGGTGGGG + Intronic
1093968986 12:25357177-25357199 CTTCCATCCAGGCCCAGGTGAGG - Intergenic
1094375975 12:29787642-29787664 CACCAGTCTGGGCCCAGGTCTGG - Intergenic
1094394499 12:29991476-29991498 CAGACATCTGGGCACCAGTGGGG + Intergenic
1095954591 12:47798866-47798888 CAGCAATGTGGGCTCTGGTGGGG + Exonic
1096145735 12:49277412-49277434 CTGCCACCTGGGCCCAGGAACGG - Intergenic
1096409130 12:51364669-51364691 CAGCCCTCCGGGCCCACGTGTGG + Intronic
1096554421 12:52394743-52394765 CCACCATCTGGGCCTAGCTGAGG + Exonic
1096651722 12:53065173-53065195 CACCCATGTGGGTCCAGGTATGG + Exonic
1096744215 12:53714997-53715019 CACACATCTGGGCCCAGTAGAGG - Intronic
1097250873 12:57631826-57631848 CAGGCATCTGAGCCCAGCAGTGG + Intronic
1103342023 12:120225850-120225872 CAGGCAGCTGGGACAAGGTGTGG - Intronic
1103486780 12:121288442-121288464 CTGCCCTCTAGGTCCAGGTGTGG - Intronic
1103971589 12:124675951-124675973 CAGCCATCCGTGGCCTGGTGGGG - Intergenic
1104986217 12:132598851-132598873 CCGCGGTCTGGGCCCAGGTGAGG - Intergenic
1109455268 13:62579340-62579362 CAGCCCTCTGGCTCCATGTGTGG - Intergenic
1110369886 13:74727950-74727972 CATTTATCTGGGCCCAGATGGGG - Intergenic
1111937233 13:94569851-94569873 CAGCCATTTCTGCCCAGGTGGGG + Intergenic
1113589554 13:111488889-111488911 CAGCCAGCTGCTACCAGGTGTGG + Intergenic
1113788108 13:113013460-113013482 CAGCCAGCACGGCCCAGGAGGGG + Intronic
1115733495 14:36297478-36297500 CAGTCAGCTGGGGCCAGATGGGG - Intergenic
1118541447 14:66831854-66831876 CAACCATATGAGGCCAGGTGTGG + Intronic
1119749677 14:77068317-77068339 TACCCACCTGGGCCCAGGTAGGG - Intergenic
1121661235 14:95636653-95636675 CAGCTCCCTGGGCCCAGGAGGGG + Intergenic
1121946002 14:98122637-98122659 CAGCTATCTGAGGCCAGGAGAGG + Intergenic
1122103301 14:99430840-99430862 CAGTCCGCTGGACCCAGGTGAGG - Intronic
1122551598 14:102552966-102552988 CAGGTGTCTGGGGCCAGGTGGGG + Intergenic
1122959633 14:105088456-105088478 CAGCCAGCGGGGCCGAGGGGAGG + Intergenic
1123068538 14:105629973-105629995 CAGCCACCAGGGCCCAGTGGGGG - Intergenic
1123072537 14:105648772-105648794 CAGCCACCAGGGCCCAGTGGGGG - Intergenic
1123098123 14:105775999-105776021 CAGCCACCAGGGCCCAGTGGGGG - Intergenic
1124516028 15:30368021-30368043 CTTCCACCTGGGCCCAGGTGAGG + Intronic
1124726892 15:32162710-32162732 CTTCCACCTGGGCCCAGGTGAGG - Intronic
1125730937 15:41892494-41892516 CAGCCAACAGAGCCCAGATGTGG - Intronic
1125756260 15:42067176-42067198 CACACACCTGGCCCCAGGTGGGG - Intronic
1125795232 15:42399446-42399468 GAGCCATATGGGAGCAGGTGAGG - Intronic
1127048184 15:55050116-55050138 CAGCCAGCTGGCCACAGTTGAGG + Intergenic
1127269765 15:57390104-57390126 CTGGGATCTGGGGCCAGGTGCGG - Intronic
1127993253 15:64136091-64136113 CAGGCATCTGGGACCAAGTGTGG - Intronic
1128008689 15:64270096-64270118 CAGCCATCAGAGGCCAGGTGTGG - Intronic
1128262107 15:66239746-66239768 ATGACTTCTGGGCCCAGGTGAGG + Intronic
1129600954 15:76997852-76997874 CAGCCAGCTTGGCCCATGTCTGG + Intronic
1129682297 15:77664684-77664706 CAGCCAACTTGGACCAGGTAGGG - Intronic
1130411161 15:83649863-83649885 AACACATCTGGGGCCAGGTGCGG - Intergenic
1130660462 15:85827817-85827839 CAGCCAAATAGGGCCAGGTGCGG - Intergenic
1131347205 15:91661404-91661426 CAGCCATCTGGGGCCAGGCCGGG + Intergenic
1132911219 16:2313262-2313284 AGACCATCTGGGGCCAGGTGTGG + Intronic
1132986155 16:2768719-2768741 AAGGCCTCTGGGCTCAGGTGTGG - Intronic
1133768521 16:8854481-8854503 CAGCCTGCTGTGCCCAGGGGTGG + Exonic
1134552884 16:15146143-15146165 CTGCCATCCTGGCCCACGTGTGG - Intergenic
1135497783 16:22967699-22967721 CAGCCATGTGGGCCAAGGGCTGG - Intergenic
1136234617 16:28905937-28905959 GAGCCACCGGGGCCCAGGCGTGG - Intronic
1137537131 16:49335978-49336000 CAGCCACGTGGGACCAGGTGAGG - Intergenic
1137598065 16:49737954-49737976 CAGCCATGTGGCCCCAGAGGTGG - Intronic
1138114318 16:54348400-54348422 AAGCACTCTGGGGCCAGGTGTGG - Intergenic
1138448470 16:57079059-57079081 CAGCCATCTGGGCCCAGGTGGGG + Exonic
1139174826 16:64674334-64674356 TAGCAATGTTGGCCCAGGTGAGG - Intergenic
1139440749 16:66965471-66965493 CCACCATCTGGGGCCAGGTGAGG - Intronic
1141263716 16:82476553-82476575 CAGCTAAATGGGACCAGGTGAGG + Intergenic
1141919409 16:87126005-87126027 CAGCCATATGGGCACAGCTGGGG + Intronic
1141943793 16:87296393-87296415 CAGCTCCCTGGTCCCAGGTGGGG - Intronic
1142500035 17:327180-327202 GAGTCAGCTGGACCCAGGTGTGG + Intronic
1143497415 17:7320423-7320445 TAGCCAGCTGAGCCCGGGTGCGG - Intronic
1146057681 17:29589399-29589421 CAGCCCTCTGGGCCAGCGTGGGG + Exonic
1146667757 17:34716169-34716191 CAGCTCTCTGGGCCCACGGGAGG - Intergenic
1147861865 17:43528532-43528554 CAGCCATTTGGCCCCAAGGGTGG - Exonic
1148905245 17:50907830-50907852 GAGCCATGAGGGCCCTGGTGAGG - Intergenic
1149842375 17:59977330-59977352 CAGCAATATAGGGCCAGGTGTGG + Intergenic
1150634783 17:66905315-66905337 CAACCAGCTGGGCCCTAGTGAGG - Intergenic
1151620600 17:75242698-75242720 CAGCCACCGGGGCACAGGTAGGG + Intronic
1152117105 17:78395046-78395068 CTGCCATCTGGGCTGAAGTGTGG + Intronic
1152236038 17:79139386-79139408 CAGCCAGCAGGGCCAAGATGCGG - Intronic
1152602931 17:81274200-81274222 CAGGCACCTGGGCACGGGTGAGG - Intronic
1152644074 17:81460816-81460838 CAGCTTTGTGGGCCCAGCTGGGG + Intronic
1152656972 17:81524278-81524300 TTGCCCTCTGGGCTCAGGTGAGG + Intergenic
1152831615 17:82500773-82500795 CAGCCATAGGGCCCCAGGTAGGG - Intergenic
1153545902 18:6204388-6204410 GAGCCATCAGGGCTCAGCTGTGG - Intronic
1155088798 18:22485647-22485669 CATCTTTCTGGGCCCAGTTGAGG + Intergenic
1156637541 18:39049450-39049472 CAGCCATCTGGACACAGAAGGGG + Intergenic
1157595458 18:48861200-48861222 CTGCCCTCTGGTCCCAGGTGTGG + Exonic
1158315070 18:56203242-56203264 TAGCCAACTGGGCCCTGGGGAGG + Intergenic
1159912521 18:74159896-74159918 CCGGCATCTGAGCTCAGGTGGGG + Exonic
1160569233 18:79805422-79805444 CAGCCAGCAGGGCCCAAGTCTGG - Intergenic
1160729228 19:633194-633216 CAGCCTCCTGACCCCAGGTGTGG - Intronic
1160810350 19:1010490-1010512 CAGCCCGCTGGGCCCTGCTGGGG - Exonic
1161058489 19:2202248-2202270 CAGACAACGGGTCCCAGGTGAGG - Intronic
1161425416 19:4200175-4200197 CTGCCAGCTGGGCCCCGGGGAGG + Intronic
1162213498 19:9112682-9112704 CAGCCATCTGGGTCCATGAGGGG + Intergenic
1162440485 19:10689120-10689142 CAGCCAGCGGGGCTCAGGTTAGG - Intronic
1162971251 19:14182701-14182723 CAGCCCTCCCGGCCCAGCTGGGG + Intronic
1163303199 19:16461013-16461035 AAGCCAGCTGGGGCCAGGCGCGG + Intronic
1163374706 19:16923021-16923043 CAGCCCTCTGTCCCCAGGCGTGG + Intronic
1163782165 19:19256347-19256369 CAGCCATCAGGCCCCTGATGGGG + Exonic
1163934742 19:20432630-20432652 CACCCATCTGTGCACAGATGAGG - Intergenic
1164882122 19:31741306-31741328 AAAGCATCTGGGCACAGGTGCGG + Intergenic
1164933999 19:32197188-32197210 CACCCCTCTGGCCCCAGGTAGGG + Intergenic
1165223198 19:34334761-34334783 AAACCATATGGGGCCAGGTGGGG + Intronic
1165413702 19:35678079-35678101 CAGCCATCCAGGCCCAGCGGAGG - Exonic
1166810352 19:45510514-45510536 CTGCCATGAGGGGCCAGGTGTGG - Intronic
1167504160 19:49862571-49862593 CGGCCAACTGGGCCCCGGGGCGG - Exonic
1167683783 19:50942809-50942831 TAGCCACATGGGCCCGGGTGTGG + Intergenic
1168614540 19:57827114-57827136 CAGCACTCTGGGCAGAGGTGAGG - Intronic
925421723 2:3718072-3718094 CAGCCCTCTGAGGCCAGGAGTGG + Intronic
926274220 2:11391307-11391329 AAGCCATCTTGGGCCAGGCGTGG - Intergenic
926797416 2:16630290-16630312 CAGTGGTCAGGGCCCAGGTGGGG - Intronic
927510653 2:23642126-23642148 CAGCCATCGGGGCTCAGAGGAGG - Intronic
927577222 2:24209694-24209716 GAGCGATCTGGAACCAGGTGAGG + Intronic
929053356 2:37856318-37856340 CAGCCCTGTGGGCCAGGGTGGGG - Intergenic
929610538 2:43267683-43267705 CTGCCATCTGGGGCCATGTGAGG + Intronic
929835865 2:45398283-45398305 CAGCTATCTGGGCATGGGTGGGG + Intronic
930994659 2:57701775-57701797 CACCCATCGGAGCCCAGGTTTGG + Intergenic
932276874 2:70458330-70458352 GAGCCATCTGGGTGCAGGAGAGG - Intronic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
934543716 2:95197130-95197152 CAACTATCTGGCCCCTGGTGTGG + Intergenic
935784828 2:106539190-106539212 CAGCACTCGGGGCCCATGTGTGG + Intergenic
936977317 2:118232750-118232772 CAGCGATAGGGGCTCAGGTGGGG + Intergenic
937361268 2:121231638-121231660 CAGCCATTTGGACCCAGACGGGG + Intronic
937452005 2:122009776-122009798 GAGCCAGCAGGGCCCAGGAGAGG - Intergenic
937909352 2:127068058-127068080 CTGGCATCTGAGCCCAGCTGGGG - Intronic
938089344 2:128421027-128421049 CCACCCTCTGGGCCCAGGAGAGG - Intergenic
938120848 2:128632078-128632100 CAGCCCTCCGGGCGCAGGTGCGG - Intergenic
938144313 2:128821217-128821239 CTGCCAGCTGGGCTCAGCTGAGG - Intergenic
938590232 2:132728810-132728832 CTGCCACCGGGACCCAGGTGAGG - Exonic
938767603 2:134470759-134470781 GAGCCATCTGGGCCTGGGTAGGG - Intronic
939994072 2:148903703-148903725 CAGCTCTCTGAGCTCAGGTGAGG - Intronic
940931405 2:159436456-159436478 TATCCATTTGGGGCCAGGTGTGG + Intronic
941613940 2:167697362-167697384 CAACCATCACAGCCCAGGTGTGG - Intergenic
946950855 2:224873284-224873306 AAGCCATCTCTGGCCAGGTGTGG + Intronic
947224786 2:227829518-227829540 AAGCAATCTGGGCACAGCTGTGG + Intergenic
948595567 2:239077202-239077224 CTGCCATCAGGGCCAAGGTCTGG + Intronic
948926185 2:241099846-241099868 TAGCCATACAGGCCCAGGTGAGG + Exonic
1169973904 20:11302041-11302063 CAGGCACCTGAGGCCAGGTGGGG + Intergenic
1170046795 20:12093961-12093983 AATCCATCAGGGTCCAGGTGTGG - Intergenic
1171981317 20:31631268-31631290 ATGCCATGTGGGCCCGGGTGGGG - Intergenic
1172023692 20:31933891-31933913 CAGCCCTCTGGCGCCAGGTCGGG + Intronic
1172271216 20:33656797-33656819 GAGCGATCTGGGCCCAGAGGAGG + Intergenic
1172297555 20:33823964-33823986 TAGCAATCTGGGGCCGGGTGTGG - Intronic
1174465773 20:50716129-50716151 AAGGCACCTGGGGCCAGGTGCGG + Intergenic
1174811920 20:53653360-53653382 TAGCCCTCTGGGCCCACGGGAGG + Intergenic
1174969221 20:55255134-55255156 CAGACATCTGGGCACCAGTGAGG - Intergenic
1175408596 20:58751549-58751571 CAGCCATGTGGTTCCTGGTGTGG - Intergenic
1175918472 20:62438585-62438607 CACCCTTCTGGGATCAGGTGGGG + Intergenic
1176219342 20:63962679-63962701 CCGCCACCTGGGCCGACGTGCGG + Exonic
1176382331 21:6119640-6119662 CAGCCATGTGTGCCCAGCAGTGG + Intronic
1176967851 21:15231559-15231581 AAGCCGTCTGGGGCCACGTGTGG - Intergenic
1179470418 21:41606403-41606425 CAGCCAACTGGGGCCAGACGTGG + Intergenic
1179731104 21:43367855-43367877 CAGGGACCTGGCCCCAGGTGGGG + Intergenic
1179741141 21:43418599-43418621 CAGCCATGTGTGCCCAGCAGTGG - Intronic
1179781213 21:43702209-43702231 CTGCCCGCTGAGCCCAGGTGTGG - Intergenic
1179882237 21:44297718-44297740 CGGCCATCTGGGGTCAGGAGGGG - Exonic
1179897007 21:44368848-44368870 CAGCTTTCAGGACCCAGGTGCGG - Intronic
1179959124 21:44758472-44758494 CAGCCACCAAGGCCCAGCTGGGG + Intergenic
1180073512 21:45450332-45450354 CAGCCTTCAGGGTCGAGGTGTGG + Intronic
1180843626 22:18970401-18970423 CAGGCGCCTGCGCCCAGGTGAGG + Intergenic
1181455509 22:23058173-23058195 CAGGCAGCTGGGCCCAGCTGGGG - Intergenic
1181546063 22:23603334-23603356 CAGCAATCTGGGCCCCTGGGTGG + Intergenic
1181638535 22:24185302-24185324 CTCCCATCAGGGCCCAGGAGAGG + Intronic
1182092269 22:27603967-27603989 CAGCCAGCTGGGGCCTGGTCTGG - Intergenic
1182573775 22:31259105-31259127 CAGCCACCTGTGAGCAGGTGGGG - Exonic
1183582964 22:38736460-38736482 GAGCCATCTGGCCCTAGGCGAGG - Intronic
950287518 3:11756573-11756595 CGGTCTTCTGGGGCCAGGTGTGG + Intergenic
951573097 3:24085829-24085851 CAGCTATTTGGGCTCAGGGGAGG + Intergenic
953413729 3:42703775-42703797 CACCCATCAGGGCCCAGGAAGGG + Intronic
953909747 3:46885815-46885837 TAGCCCTCTGGGCTCAGGAGAGG - Intronic
954875837 3:53802728-53802750 GAGCCATGTGGGCCCAAGTTGGG + Intronic
955816883 3:62853332-62853354 AAACCATCTAGGGCCAGGTGTGG + Intronic
956810780 3:72862127-72862149 CAGCCATTTCAGCCCAGGTGCGG + Intergenic
959114693 3:102162908-102162930 CAACCAGCTGAGCCCAGATGTGG + Intronic
961457497 3:127031397-127031419 CATCCACCTGACCCCAGGTGTGG - Intronic
961457840 3:127033050-127033072 CAGCCATGTGGGGTCAGGGGTGG + Intronic
961525722 3:127496214-127496236 CAGCCATCCAGGCACAGCTGTGG + Intergenic
962426097 3:135270654-135270676 CAGCAACATGGGCCCTGGTGTGG - Intergenic
963322346 3:143822544-143822566 CAGACAGCTGGGCACAGGAGGGG - Intronic
963471991 3:145752180-145752202 CAGCCTTCTGGGCTGAGGTGAGG - Intergenic
964402161 3:156310917-156310939 CAGCAATTAGGGCCCAGATGTGG + Intronic
964452654 3:156826562-156826584 CAGCCCGCGGGGCCCAGGCGCGG + Exonic
964739376 3:159949628-159949650 CACTCATCTGGCCCCAGGTAGGG + Intergenic
966642250 3:182204083-182204105 CAGCCCTCTGATCCCAGGTCTGG + Intergenic
968605269 4:1532386-1532408 CAGCCAGCTGGGCACAGGGGAGG + Intergenic
968623536 4:1615403-1615425 CTTCCATGTGTGCCCAGGTGGGG - Intergenic
968832503 4:2940339-2940361 CATCCACATGGGCCCAGGAGTGG - Intronic
969341253 4:6543147-6543169 CAGCCATCTGGGCCCAAGGCAGG + Intronic
969365278 4:6690522-6690544 CAGTCAGTCGGGCCCAGGTGGGG - Intergenic
969582028 4:8071262-8071284 CAGCCATCCCGGCCCAGGAGTGG + Intronic
969703502 4:8780318-8780340 CAGCCAGCTGGGTCCTGCTGCGG + Intergenic
972265350 4:37454024-37454046 CCGCCGTCTGGCCCCAGGTAGGG + Intronic
972375404 4:38465106-38465128 CAGCCATCTTGGTCCAGGGAAGG - Intergenic
975260135 4:72288154-72288176 CAGCAAAATGGGGCCAGGTGCGG - Intronic
975714605 4:77193564-77193586 CAGCCGTCTGGGACCAATTGCGG + Intronic
978953390 4:114588975-114588997 CAGCCACCTGGGCACAGGATGGG - Intergenic
980900269 4:138898400-138898422 CAGCCATCTCAGATCAGGTGAGG - Intergenic
983261556 4:165462276-165462298 CAGACATCTGGGGGCAAGTGTGG + Intronic
984717598 4:182940168-182940190 CAACCATGTGGGGCCAGGCGCGG + Intergenic
984919103 4:184748360-184748382 CTGACAGCTGGGCCCGGGTGAGG + Intergenic
984959909 4:185086489-185086511 CGGCCATCTGGACCAAGGTGAGG - Intergenic
985018815 4:185665777-185665799 CAGACCTCTGACCCCAGGTGGGG + Intronic
985056576 4:186040954-186040976 AAGCCATCTTGGGCCAGGCGCGG - Intergenic
985931836 5:3064524-3064546 CAGCCTGCTGGGCGCAGGTGCGG - Intergenic
985948309 5:3203597-3203619 CAGCCACCTTGGCCCAGGAGAGG + Intergenic
986928570 5:12790732-12790754 CAGACATCTGGGCACCAGTGAGG - Intergenic
988307020 5:29505871-29505893 CATCCATCTGGCTCCTGGTGAGG + Intergenic
992766762 5:80007986-80008008 CAACAAACTGGGCCCAGGTCTGG + Intronic
996398184 5:123033955-123033977 CAGCCATAGAGGCTCAGGTGGGG - Intronic
997410598 5:133687914-133687936 GAGCCATCTGGGACCTGGGGAGG - Intergenic
997711321 5:136007127-136007149 CAGCCAGCCGTGCCCATGTGTGG - Intergenic
997718426 5:136059153-136059175 GAGGCATCGGGGCCCTGGTGCGG + Exonic
997779282 5:136640724-136640746 GATCCCTCTGGCCCCAGGTGTGG + Intergenic
998403940 5:141863154-141863176 GAGCCATCTGGACCGAGGTGTGG - Intronic
999094187 5:148963676-148963698 CAGCCATCTTGGGCCAGGATGGG - Intronic
999307303 5:150528038-150528060 CCGGCGTCTGCGCCCAGGTGTGG - Exonic
1000934685 5:167293508-167293530 CAACAATCAGGGGCCAGGTGCGG - Intronic
1001176539 5:169474189-169474211 CAGCCATTTGGGACCAGGAAAGG - Intergenic
1001425204 5:171618159-171618181 CAGCCAGCTGGGCCATGGAGAGG + Intergenic
1001722360 5:173867118-173867140 CAATCATCTGTGCCCAGGGGTGG - Intergenic
1002332138 5:178450455-178450477 CAGCCAGCGGGGGCCAGGAGAGG + Intronic
1002839903 6:896565-896587 CATACCTCTGGGGCCAGGTGTGG + Intergenic
1002886134 6:1295980-1296002 CAGCCATCTAAGCTAAGGTGTGG - Intergenic
1003076399 6:2987179-2987201 CAACTATCTGGCCCCATGTGGGG + Intergenic
1004248175 6:14000424-14000446 CTGCCTTCTGGGCCCAGGATGGG - Intergenic
1004623095 6:17348609-17348631 AAGACATCTTGGGCCAGGTGCGG + Intergenic
1006719068 6:36138489-36138511 CAGCCCACTGGGCCCACGTCAGG - Intronic
1006771218 6:36554453-36554475 AAACCAACTGGGGCCAGGTGCGG + Intergenic
1007427301 6:41755945-41755967 CAGCCAGCTGTGCACAGGTAAGG - Intergenic
1007842606 6:44728983-44729005 CAGCCCTTAGGGCCCAGGAGTGG - Intergenic
1010209920 6:73354440-73354462 GAGACAGCTGGGCCCGGGTGAGG - Intergenic
1013052708 6:106552293-106552315 CAGACATTTGGGGCCGGGTGTGG + Intronic
1013627286 6:111950807-111950829 CAGCCAGCTGGAGCTAGGTGGGG - Intergenic
1014001694 6:116371556-116371578 CAGCCATTTGGGGGCAGGGGAGG + Intronic
1017507182 6:155079350-155079372 TGGCCATCTGGGTCCAGGCGAGG - Intronic
1018372067 6:163177591-163177613 CAGGCAACAGGGCCAAGGTGTGG + Intronic
1018395677 6:163376420-163376442 CAGGCATCAGATCCCAGGTGTGG - Intergenic
1018946418 6:168349394-168349416 CTGCCATCTGGGCCCTGGGCTGG - Intergenic
1019078704 6:169412507-169412529 AAGCCCTCTTGCCCCAGGTGGGG - Intergenic
1019117204 6:169774741-169774763 CAGCCATCAACGCCCAGGTCAGG - Intronic
1019428586 7:988424-988446 CAGCCCTCGGGGCCGGGGTGGGG + Intronic
1019514047 7:1432034-1432056 CAGCCACTCGGGCACAGGTGGGG - Intronic
1019592461 7:1842579-1842601 CAGCCACCTGAGCCCCGGCGAGG + Intronic
1020087929 7:5321426-5321448 CAGACATCTGGGGCCAGGCAGGG - Intronic
1020134744 7:5580927-5580949 AAACCACGTGGGCCCAGGTGCGG - Intergenic
1020812730 7:12865313-12865335 CAGCATTCTGGACCCATGTGGGG + Intergenic
1023166122 7:37345419-37345441 AAGACATCTGAGGCCAGGTGCGG + Intronic
1023283080 7:38591575-38591597 GAGCCATTTGGGGCCAGGCGTGG - Intronic
1025206369 7:56995676-56995698 CAGACATCTGGGGCCAGGCCGGG + Intergenic
1025665566 7:63581251-63581273 CAGACATCTGGGGCCAGGCCGGG - Intergenic
1026050686 7:66944083-66944105 AAGCCATCTGAGGCCAGGTACGG - Intronic
1026390089 7:69892079-69892101 AAGATATCTGGGGCCAGGTGTGG - Intronic
1026451310 7:70531955-70531977 CAGTCATCTGTGGCCAGCTGGGG + Intronic
1026878696 7:73894582-73894604 CAGCCAGGTGGGCCCAGGTGAGG - Intergenic
1030330800 7:108268454-108268476 CAGCCATCTTTGCACAGTTGAGG - Intronic
1032468390 7:132161136-132161158 CTGTCCTCTGGGCCCTGGTGGGG + Intronic
1032511309 7:132474762-132474784 CAGCCATGTGAGCCCAGGCAAGG - Intronic
1033310838 7:140260691-140260713 CAGTCCTCTGGGGACAGGTGAGG + Intergenic
1034158966 7:148978451-148978473 CAGCCACCTGGGCCCTGATGTGG - Intergenic
1034292783 7:149945921-149945943 CAGCTATCTGGGAACAGGTGTGG + Intergenic
1034813286 7:154150951-154150973 CAGCTATCTAGGAACAGGTGTGG - Intronic
1034874094 7:154709920-154709942 CACCCATCAGGGGCCATGTGTGG + Intronic
1037539613 8:19858257-19858279 CAGCCATCTGGCACCAGTGGAGG + Intergenic
1037861338 8:22407649-22407671 CACCATTCTGGGGCCAGGTGCGG - Intronic
1037906673 8:22719560-22719582 CAGACTTCTGGGCCCCAGTGGGG - Intronic
1038282958 8:26182285-26182307 CAGCCATTTCAGCCCAAGTGGGG + Intergenic
1038764205 8:30412362-30412384 CAGTCATCTGGGCTCAGGGCTGG - Intronic
1039065874 8:33607004-33607026 CAACCATCTGGGGCTGGGTGAGG - Intergenic
1039785537 8:40831491-40831513 CAGCCATCAGGGCCCCAGGGTGG + Intronic
1040021307 8:42743883-42743905 CAGCAATCCGTGCCCAGATGTGG + Intergenic
1040349841 8:46553528-46553550 CAGGCATGTGCCCCCAGGTGTGG - Intergenic
1040816421 8:51512743-51512765 CAGCCATCTGGGCACCAGCGAGG - Intronic
1044457362 8:92403799-92403821 CTGCAATCAGGGCCCAGGAGAGG - Intergenic
1047402862 8:124560806-124560828 CACCCATCTGTGCCCAGGAGTGG - Intronic
1047632529 8:126724004-126724026 CCGCCATCAGGCCCCAGATGTGG - Intergenic
1048470170 8:134698030-134698052 GACCCAACTGGGGCCAGGTGCGG + Intronic
1048761249 8:137798088-137798110 CAGCAATCTGGGCTCAGCAGAGG + Intergenic
1049396416 8:142403098-142403120 GAGCCACCGAGGCCCAGGTGAGG - Exonic
1049520786 8:143089141-143089163 CAGACACCAGGGCACAGGTGGGG + Intergenic
1049601383 8:143509415-143509437 CCCCCAGCTTGGCCCAGGTGGGG - Intronic
1052494863 9:29213159-29213181 CAGCCAAGTTGGCCCAGGAGGGG - Intergenic
1052872078 9:33517157-33517179 AAGCCATTAGGGGCCAGGTGTGG + Intergenic
1053208731 9:36209699-36209721 CTGCCACCTGCTCCCAGGTGGGG - Intronic
1056299636 9:85227741-85227763 CAGTGAGCTGGGCCCAAGTGTGG - Intergenic
1056556542 9:87694544-87694566 CAGCCATATGCGGCCAGCTGGGG + Intronic
1056691647 9:88813251-88813273 CTGCCTTCTGGGCCCAGGAAGGG + Intergenic
1056985613 9:91361728-91361750 CGGCGATCTGGGCCCAGGGCTGG - Exonic
1057305749 9:93911076-93911098 CAGCCCTATGGAGCCAGGTGGGG - Intergenic
1057685530 9:97230815-97230837 AAGCCATTAGGGGCCAGGTGTGG - Intergenic
1057903574 9:98967487-98967509 CAGCCAAGTGGCCCCAGCTGTGG - Intronic
1059346785 9:113634450-113634472 CAGGCAACTGGGCCCACCTGTGG - Intergenic
1059484783 9:114618165-114618187 AAGATATCTGGGGCCAGGTGTGG - Intronic
1059755978 9:117293727-117293749 CAGCCAGCTGGGCCAAGGCAAGG + Intronic
1060009573 9:120031798-120031820 GTGCCCTCTGGGCCCAAGTGGGG - Intergenic
1060189302 9:121582064-121582086 CAGTCATCTGGGGCCAAGAGGGG + Intronic
1060220588 9:121762191-121762213 CAGCCACCTGGGGCCAGATCTGG - Intronic
1060679587 9:125549832-125549854 CTTCCAGCTGGGCACAGGTGGGG + Intronic
1061392624 9:130326244-130326266 CAGTCAGCTGGGCCCAGAGGTGG - Intronic
1062326828 9:136016537-136016559 TGCCCACCTGGGCCCAGGTGAGG + Intronic
1185672988 X:1826503-1826525 CTGAAATCTGGTCCCAGGTGAGG - Intergenic
1185720967 X:2381154-2381176 CAGGGATCTGGGGCCGGGTGTGG - Intronic
1186747385 X:12583726-12583748 CAGACAGCTGGGCCCGGGTGAGG - Intronic
1189131072 X:38498605-38498627 CAGCCACCTTGGCCCAACTGAGG + Intronic
1190335785 X:49260903-49260925 CAGCAGGCTTGGCCCAGGTGGGG + Intronic
1191108059 X:56784401-56784423 CACTCATCTGTGCCCAGGGGTGG + Intergenic
1193084399 X:77436451-77436473 CAGCCAGCTGGCCCCAGTTATGG + Intergenic
1194258809 X:91668775-91668797 CAGATATCTGAGCCCAAGTGTGG - Intergenic
1196212721 X:113013274-113013296 GAGCCATTTTGGGCCAGGTGCGG - Intergenic
1196722694 X:118869658-118869680 GAGCATTTTGGGCCCAGGTGTGG - Intergenic
1197730308 X:129804155-129804177 GAGCCATCTGAGCCCAGGAGAGG + Exonic
1198249982 X:134870525-134870547 CAGCCCTTGGGGCCCAGCTGAGG + Intergenic
1200101631 X:153691500-153691522 CAGCAAGCTGGTCACAGGTGAGG - Exonic
1200389341 X:155928211-155928233 CAGCCAAAGGGGGCCAGGTGTGG - Intronic
1200392026 X:155954507-155954529 CAGACATCTGGGCGCCAGTGAGG - Intergenic
1201417408 Y:13761154-13761176 AAGCTATCTGGGGCCAGGCGTGG + Intergenic