ID: 1138450691

View in Genome Browser
Species Human (GRCh38)
Location 16:57092274-57092296
Sequence CGGGCAAAGCAGGCCTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138450680_1138450691 18 Left 1138450680 16:57092233-57092255 CCTGAGCGCACGGCGCTCGGAAC No data
Right 1138450691 16:57092274-57092296 CGGGCAAAGCAGGCCTGGGGAGG No data
1138450679_1138450691 19 Left 1138450679 16:57092232-57092254 CCCTGAGCGCACGGCGCTCGGAA No data
Right 1138450691 16:57092274-57092296 CGGGCAAAGCAGGCCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138450691 Original CRISPR CGGGCAAAGCAGGCCTGGGG AGG Intergenic
No off target data available for this crispr