ID: 1138453678

View in Genome Browser
Species Human (GRCh38)
Location 16:57108487-57108509
Sequence AGTTGGAACCTGGCCATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138453672_1138453678 9 Left 1138453672 16:57108455-57108477 CCACTTAGCCTCAGGAGGACAAA 0: 1
1: 0
2: 0
3: 10
4: 176
Right 1138453678 16:57108487-57108509 AGTTGGAACCTGGCCATTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 123
1138453673_1138453678 1 Left 1138453673 16:57108463-57108485 CCTCAGGAGGACAAAGTATTAGG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1138453678 16:57108487-57108509 AGTTGGAACCTGGCCATTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138453678 Original CRISPR AGTTGGAACCTGGCCATTGT TGG Intronic
903537461 1:24076464-24076486 AGATGGAACCTGGTGATTGGTGG - Intronic
904832853 1:33316508-33316530 ATCTGGAGCCTGGCCATGGTGGG + Intronic
907595205 1:55713253-55713275 TGTTGGGACCTGGTCAGTGTGGG + Intergenic
907595576 1:55716528-55716550 TGTTGGAACCTGGTTAGTGTGGG + Intergenic
911567288 1:99477540-99477562 ACTTTGAACCTGGACATTATTGG - Intergenic
911964336 1:104347277-104347299 AGTTTGAAATTGGCCATGGTAGG + Intergenic
912862566 1:113227050-113227072 AGTGGGTACCTGGGCATTGTTGG + Intergenic
913207767 1:116556907-116556929 ATTGGGAACCTGGCAATGGTGGG - Intronic
915285635 1:154850305-154850327 AGCTGGACCCTGACCCTTGTTGG - Intronic
920319402 1:205106640-205106662 AGTTGAAACCTGGGCATTTTGGG - Intronic
921180207 1:212625976-212625998 AGTGTGAGCCTGGCCATTGCAGG + Exonic
921879629 1:220240217-220240239 AGTTGTAACATGGCCACTTTAGG - Intronic
922067864 1:222161398-222161420 AGTTGTAACCTGACCACTTTGGG + Intergenic
1068618668 10:59152291-59152313 AGCTTGAAACTGGCCATAGTGGG - Intergenic
1069624974 10:69862031-69862053 AGCTGGAAATTGGCCATGGTGGG - Intronic
1069693976 10:70373552-70373574 ATTTCCAACCTGGCCATAGTAGG - Intronic
1069786492 10:70991403-70991425 AGCTGGAAACTGGCCGTGGTGGG - Intergenic
1070090604 10:73281587-73281609 AGTTTGAAATTGGCCATGGTAGG - Intronic
1070248698 10:74754695-74754717 AGTTTGAAATTGGCCATGGTGGG - Intergenic
1070766572 10:79060044-79060066 AGCTTGAAACTGGCCATGGTGGG + Intergenic
1073154458 10:101335485-101335507 AGTTGAAGCCTGGCCATGGAAGG + Intergenic
1073773145 10:106757351-106757373 GCTTGGAACCTGGCTATTGGGGG - Intronic
1073899482 10:108203674-108203696 GGTTGAAAACTGGCTATTGTGGG + Intergenic
1074060307 10:109959449-109959471 AGTTGGAGCCTTGCCCTTGTGGG + Intergenic
1079303452 11:19300483-19300505 AGCTGGAAACTGGCCATGGGAGG + Intergenic
1084357100 11:68647000-68647022 TGTTGGTAACTGGACATTGTAGG + Intergenic
1087480210 11:98691382-98691404 TGTTTGAAGCTGGGCATTGTAGG + Intergenic
1087679989 11:101209731-101209753 GGTAGTAAACTGGCCATTGTGGG - Intergenic
1088640420 11:111867709-111867731 AGTTGAAAGCTGGACATTTTAGG + Intronic
1088983502 11:114885534-114885556 AATTTGAAATTGGCCATTGTAGG - Intergenic
1089726846 11:120488617-120488639 AGTTGGCACCTGGAAATGGTGGG - Exonic
1090256135 11:125285960-125285982 AGCTTGAAACTGGCCATGGTGGG + Intronic
1091971674 12:4792694-4792716 AGTTTGAAACTGGCCATGGTGGG - Intronic
1092129695 12:6101285-6101307 AGCTTGAAACTGGCCATGGTAGG - Intronic
1095327167 12:40908780-40908802 AGGTTGAAACTGGCCATGGTAGG - Intronic
1095392125 12:41720330-41720352 AGCTGGAAATTGGCCATGGTAGG - Intergenic
1098223087 12:68291132-68291154 AGTTAGAAATTGGCCATGGTGGG - Intronic
1110191696 13:72737280-72737302 AGCTTGAAACTGGCCATGGTTGG - Intronic
1110391614 13:74981183-74981205 AGTTGAAAGCTGGCCCTTTTAGG - Intergenic
1110819713 13:79900494-79900516 AGTTTGAAATTGGCCATGGTGGG - Intergenic
1112805230 13:103157577-103157599 AGCTTGAACTTGGCCATGGTGGG + Intergenic
1115060574 14:29184245-29184267 AGTTGGAAGCTAGCCAAGGTTGG - Intergenic
1117667700 14:58074582-58074604 GGTTGGAAATTGGCCATGGTGGG - Intronic
1125680477 15:41527337-41527359 AGCTGGACCCTGGGCATTGATGG + Intronic
1125843411 15:42827345-42827367 TGTTGGAAACTGGGCATTTTAGG - Intronic
1126539710 15:49808378-49808400 AGTTTGAAATTGGCCATGGTGGG + Intergenic
1128438855 15:67683674-67683696 AGCTTGAACCTGGGCATTGGAGG + Intronic
1128495051 15:68193058-68193080 TGTTGTACCCTGGCCATTGCTGG + Exonic
1131160241 15:90101056-90101078 ACTTGGAACCTGGGAGTTGTTGG + Intronic
1131378857 15:91947548-91947570 ACTAGGAGCCTGGTCATTGTGGG + Intronic
1138453678 16:57108487-57108509 AGTTGGAACCTGGCCATTGTTGG + Intronic
1139346794 16:66308971-66308993 AGTAGGAGCCTTGCAATTGTTGG - Intergenic
1141865629 16:86748011-86748033 AGGTGGAACCAGGCCAGTGTAGG + Intergenic
1143005353 17:3828920-3828942 AGTTGGATCCTCTCCTTTGTTGG + Intronic
1143775636 17:9196970-9196992 AGTTTGAAATTGGCCATGGTGGG + Intronic
1150154189 17:62836694-62836716 AGTTGAAACTTGGACATTTTTGG - Intergenic
1150818823 17:68418146-68418168 AATTGTAAGCTGGACATTGTTGG + Intronic
1151027466 17:70695407-70695429 AGTTTGAAGCTGGCAAGTGTTGG + Intergenic
1151110115 17:71666441-71666463 AGCTTGAACCTGGCCATGGCGGG + Intergenic
1151430141 17:74056689-74056711 TGTTGGAAGCTGGGCCTTGTGGG + Intergenic
1157403357 18:47404340-47404362 AGCTTGAAACTGGCCATGGTGGG + Intergenic
1163236363 19:16032710-16032732 AGTTGGAACCTTGTCACTTTGGG + Intergenic
1165051511 19:33144576-33144598 AGGTGGAAACTGGCCATGCTGGG - Intronic
1165342771 19:35224562-35224584 AGATGGAACCAGGCCATTCTTGG - Intergenic
926004297 2:9360609-9360631 AGCTTGAAATTGGCCATTGTGGG - Intronic
926548882 2:14276495-14276517 AATTGTGACCTGGACATTGTAGG + Intergenic
928742288 2:34369342-34369364 AGTTGGAACCTGGCGAACCTAGG + Intergenic
935365970 2:102291434-102291456 ACTTGGAACCTGGACCTTCTGGG - Intergenic
940723630 2:157309296-157309318 AGCTGGAAACTGGCCATATTGGG + Intronic
945812858 2:214569502-214569524 AGCTTGAAACTGGCCATGGTGGG - Intronic
946436223 2:219657418-219657440 AGTTTGAAATTGGCCATTGTGGG + Intergenic
947589590 2:231377994-231378016 AGCTTGAAACTGGCCATGGTGGG + Intergenic
948511629 2:238470002-238470024 AGTTGTATCCTGGACATTTTGGG + Intergenic
948986148 2:241525355-241525377 AATTGGAACCTGTGCACTGTTGG + Intergenic
1169472147 20:5895725-5895747 AGCTTGAACTTGGCCATGGTGGG - Intergenic
1170892969 20:20391615-20391637 GGCTGGAACCTGGCCTTTGTAGG - Intronic
1172578647 20:36029503-36029525 AGTTTGAAACTGGCCATGGTGGG - Intronic
1173239818 20:41284526-41284548 AGTGGAGAACTGGCCATTGTTGG - Intronic
1173909696 20:46657432-46657454 GTTTGGAACCTGGACATTTTGGG + Intronic
1174961127 20:55158685-55158707 AGTTGAAACCTGGCCATTTGGGG + Intergenic
1176689701 21:9890102-9890124 AGTTGGAAGCTGACAAATGTTGG - Intergenic
1177999676 21:28146540-28146562 AATTGAAACTTGGCCATTTTTGG - Intergenic
1178565812 21:33683368-33683390 TGTTTGAACCTGTCCATTGAGGG + Intronic
1178739184 21:35181449-35181471 AGATGGAAAGTCGCCATTGTTGG + Intronic
1179036808 21:37765265-37765287 AGCTGGAAATTGGCCATGGTGGG + Intronic
1180054210 21:45348826-45348848 AGTTGGGCCCAGGGCATTGTCGG + Intergenic
1181870712 22:25896814-25896836 AGTTTGAAATTGGCCATGGTGGG - Intronic
1182099779 22:27649723-27649745 AGTGGGAACCTAGCCATGCTTGG + Intergenic
950498723 3:13350400-13350422 TGTTGGAAACTGGACATTTTAGG - Intronic
953772960 3:45792760-45792782 AGTCTGAAACTGGCCATGGTGGG + Intronic
962066441 3:131986281-131986303 AGCTTGAACTTGGCCATGGTGGG - Intronic
963287217 3:143444870-143444892 TGTTGGAAGCTGGCCCATGTGGG + Intronic
966657063 3:182371194-182371216 AGGTGCAGCCTGGGCATTGTGGG - Intergenic
971599828 4:28578185-28578207 AGCTTGAACTTGGCCATGGTGGG - Intergenic
973316487 4:48765954-48765976 AGTTTGATACTGGCCATTCTGGG - Intronic
974230133 4:59101490-59101512 AGTTGGAACTTGGGCCTAGTAGG - Intergenic
974233688 4:59152243-59152265 ACTTGTAACCTAGCCATTGGAGG + Intergenic
974813060 4:66970713-66970735 AGTAAGAGCATGGCCATTGTGGG + Intergenic
979358781 4:119736732-119736754 AGTTTGAACTTGGCCATTATGGG - Intergenic
980878288 4:138684209-138684231 AGTAGGAACAGGGCCATTGCTGG + Intergenic
981616395 4:146648393-146648415 AGTTGGGACCTGGCCTGTGCAGG + Intergenic
983858747 4:172678131-172678153 AGTTGAAAACAGGCCATTTTAGG - Intronic
988555073 5:32229475-32229497 GGTAGTAAACTGGCCATTGTGGG + Exonic
989485009 5:41979558-41979580 AGTTTGAAACTGGCCATGTTGGG - Intergenic
989810558 5:45667801-45667823 ACTGGGAACATGGCTATTGTCGG - Intronic
992775447 5:80084900-80084922 AGTTTGAAATTGGCCATGGTGGG + Intergenic
992972326 5:82074564-82074586 AGTGGTAACCTGGGCTTTGTTGG + Intronic
996296702 5:121926825-121926847 TCTTGGAACCTGGCAATGGTGGG - Intergenic
997131229 5:131278526-131278548 AGCTTGAAACTGGCCATGGTGGG + Intronic
997274256 5:132570560-132570582 AGTTGGAAGCTAGCAATGGTTGG - Intronic
998662509 5:144255446-144255468 AATTGGAACCTGCACACTGTTGG - Intronic
1003529964 6:6928994-6929016 GGTTGGAACCTGGCCCGTGCAGG - Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1008325332 6:50174139-50174161 AGATTGATCCAGGCCATTGTGGG - Intergenic
1012264339 6:97122885-97122907 AGTGTGAACCTGGCCACTGCAGG + Intronic
1016047388 6:139494916-139494938 AGATTGAAACTGGCCATGGTGGG - Intergenic
1023919340 7:44615169-44615191 ACTTGCAACCTGGACATTCTGGG + Intronic
1024822256 7:53346096-53346118 ATTTGGAACGTTGCCATTTTTGG + Intergenic
1029790359 7:102837155-102837177 AGTGGGAACAAGGCCATTGTTGG - Intronic
1032804786 7:135342779-135342801 ATTTGGAAACTGGTCCTTGTAGG - Intergenic
1034860597 7:154591795-154591817 TTTTGGAACCTGTCCATGGTGGG - Intronic
1038904354 8:31881851-31881873 AGTTGGAACCTGGCAGAGGTTGG + Intronic
1044246580 8:89954411-89954433 AGTTTGAACCTGGCAATAGATGG + Intronic
1048006757 8:130425849-130425871 AGTTCTACCTTGGCCATTGTAGG - Intronic
1048652701 8:136496905-136496927 ATTTGGGACCTGAGCATTGTGGG + Intergenic
1055985699 9:82055534-82055556 AGTAGGGCCCTGGTCATTGTGGG + Intergenic
1057675418 9:97133125-97133147 AGTGGGGTCCTGGTCATTGTGGG - Intergenic
1058586471 9:106511785-106511807 TGTTGAAACCTGGACATTTTGGG - Intergenic
1061358507 9:130124632-130124654 AGCTGTAACCTGGCTATGGTGGG - Intronic
1062629611 9:137457987-137458009 AGTGGGCACCTGGCCTCTGTGGG + Intronic
1062688112 9:137826784-137826806 AGGAGGAACCTGGCCAGTGAAGG - Intronic
1062706779 9:137949988-137950010 AGTTGAAAACTGGCCATTTTTGG + Intronic
1187080987 X:15987579-15987601 AATTGGAATCTGCCCATTGCTGG + Intergenic
1187438999 X:19300293-19300315 AGCTTGAACCTGGCGATGGTGGG - Intergenic
1193812045 X:86063460-86063482 TGTTGGAACCTGGCAAGTGCTGG - Intergenic
1195409734 X:104556824-104556846 TGTTGAAACCTGGACATTTTAGG - Intergenic
1195972997 X:110494051-110494073 AGTTGGAACCTGGGTCTTGAGGG + Intergenic
1196199734 X:112872030-112872052 AGTTTGAACATGGCCATTATAGG - Intergenic