ID: 1138454410

View in Genome Browser
Species Human (GRCh38)
Location 16:57113070-57113092
Sequence GGCTGGACAGCTTGTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138454410_1138454419 30 Left 1138454410 16:57113070-57113092 CCTGCTCCACAAGCTGTCCAGCC 0: 1
1: 0
2: 2
3: 22
4: 227
Right 1138454419 16:57113123-57113145 CAGTGTCCTTGTCTGTGAGCTGG 0: 1
1: 0
2: 7
3: 90
4: 769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138454410 Original CRISPR GGCTGGACAGCTTGTGGAGC AGG (reversed) Intronic
900538746 1:3192253-3192275 GGCTCGGTAGCTTTTGGAGCTGG + Intronic
900736640 1:4303339-4303361 GGCTGGATTGCATGAGGAGCTGG + Intergenic
901853735 1:12031361-12031383 TGCCGGACAGCTTCTGGTGCTGG - Exonic
902467197 1:16625728-16625750 GTCTGGAGAGCATGTGGGGCAGG - Intergenic
903664339 1:24997330-24997352 GGCTGGATAGGTAGTGGGGCAGG + Intergenic
903778744 1:25808879-25808901 GGCAGGAGAGCAGGTGGAGCAGG - Intronic
905260512 1:36714924-36714946 GGCTGGAGAGATTGAGGAGTTGG + Intergenic
909433364 1:75615194-75615216 GTCTCGACAGGTTGGGGAGCAGG + Intergenic
913214579 1:116609880-116609902 GGCTGGAGAGCCTGAGGAGCGGG - Intronic
913449976 1:118986633-118986655 GGCTTGTCAGCGTGTGAAGCGGG + Intronic
913695410 1:121320048-121320070 GGCTGCAAAGCTTCTGGAGCAGG + Intronic
914142153 1:144960012-144960034 GGCTGCAAAGCTTCTGGAGCAGG - Intronic
915463986 1:156085249-156085271 GGGTGGGCACCTTGAGGAGCTGG + Intronic
916006902 1:160670426-160670448 GTCTGCACTGCTTGTGGAGGAGG + Intergenic
916087804 1:161283736-161283758 GGCTAGGCAGTTTGTAGAGCAGG + Intronic
919914147 1:202129712-202129734 GGATGGAGGGCTTGGGGAGCCGG + Exonic
920186689 1:204163728-204163750 CACTGTACAGCTTGTGGAACTGG + Intronic
920398510 1:205662995-205663017 GGCAGCACAGCTGGTGCAGCCGG + Exonic
920459531 1:206128668-206128690 GGCGGGGCAGGTTGTGGGGCAGG - Intergenic
920482741 1:206338427-206338449 GGCTGCAAAGCTTCTGGAGCAGG + Intronic
922799591 1:228359133-228359155 GGCTGGACAGCTTATGCCGTGGG - Intronic
923456488 1:234169638-234169660 GCCTGGACTTCCTGTGGAGCAGG - Intronic
924562347 1:245167570-245167592 AGCTCGACAGCTTTTGGTGCTGG - Intronic
1064148687 10:12844881-12844903 GGAGGGACAGCTTGAGGAGCAGG - Intergenic
1066659899 10:37728641-37728663 GGCTGCACACCTTGGGGAACAGG - Intergenic
1067472831 10:46548778-46548800 CGCTGGACAGCTTGAAGAGGTGG - Intergenic
1068576626 10:58691074-58691096 GGGTGGATAGCTTGTGGTGATGG - Intronic
1068690286 10:59906805-59906827 GGCTGGCGAGCTGGTGGTGCGGG - Intergenic
1069934242 10:71904491-71904513 GGCTGGGGAGCCTGGGGAGCAGG - Intergenic
1071026698 10:81122870-81122892 GGAAGGAAAGCCTGTGGAGCAGG - Intergenic
1073509117 10:104032203-104032225 GGCAGGACAGCTCCTGGACCAGG - Exonic
1075679257 10:124320865-124320887 GGCTGGGGAGCTTTTGTAGCTGG - Intergenic
1076361118 10:129889516-129889538 GGCTGCAGAGTTTGGGGAGCAGG - Intronic
1077025920 11:439832-439854 GACTGGACAGCTGGAGGGGCCGG - Intronic
1077974410 11:7232652-7232674 GGCTGGAGAGCTTCTCTAGCAGG - Intergenic
1080747005 11:35116988-35117010 GGCTGGGCAGGTGGTAGAGCTGG + Intergenic
1080765780 11:35295626-35295648 GGCTGGAGAGCCTGGGGAGAGGG + Intronic
1083179925 11:60978623-60978645 GGCTTTACAGGTTATGGAGCAGG + Intronic
1083272168 11:61578077-61578099 GGCTGGACAGAGTGTGGAGCTGG + Intronic
1084073806 11:66756522-66756544 GGCTGGATAGGATGTGGAGCAGG - Intronic
1085320135 11:75568994-75569016 GGCTGGAGAGCTTGTGGGCCAGG - Exonic
1086415884 11:86588685-86588707 GGATGGACAGGTTATGGAGTGGG - Intronic
1087154195 11:94885077-94885099 GGTTACACAGCTAGTGGAGCTGG - Intergenic
1089479119 11:118791071-118791093 GGCTGGACAGCCGGGGGAGCCGG - Intronic
1090094544 11:123730119-123730141 GGCTGGTCAGCTAGGGAAGCAGG - Intronic
1091111799 11:132976247-132976269 GGGTGGACAGCTGCTGGACCAGG + Intronic
1091194575 11:133720115-133720137 GACTGGGAAGCCTGTGGAGCGGG + Intergenic
1091268443 11:134288697-134288719 GGCTGCACAGCTGGTGCGGCAGG - Intronic
1094358903 12:29608849-29608871 GGCTGGACGGTTTCAGGAGCTGG - Intronic
1095877244 12:47094243-47094265 AGCTAGACAGCTTTAGGAGCAGG + Intronic
1096771773 12:53939753-53939775 GGCTGGGCTGCCTATGGAGCCGG + Intronic
1097029750 12:56081945-56081967 AGCTAGGCAGCTTGGGGAGCAGG - Intronic
1098218643 12:68245589-68245611 CACTGCACAGCCTGTGGAGCAGG + Intergenic
1098619590 12:72578298-72578320 GGCGGCACAGCTTTTGGAGCAGG + Intronic
1101918235 12:108912482-108912504 GGCTGCAGAGCTTGGGGGGCTGG - Exonic
1104481267 12:129110320-129110342 GGGTAGACAGGTAGTGGAGCTGG - Intronic
1105218306 13:18303352-18303374 GGCTGGAGAGCCTGAGGAGTGGG - Intergenic
1107958998 13:45542654-45542676 GGCTGGACAGCATGAGGGCCTGG - Intronic
1108694520 13:52891202-52891224 GGCTGGACGGCTGGTAGGGCCGG - Intergenic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1118866861 14:69711171-69711193 TGTTGGACAGCTGGAGGAGCTGG + Exonic
1119439060 14:74616057-74616079 GGCAGGACAGAGTGTGGCGCCGG - Intergenic
1120230714 14:81837577-81837599 TCCTGTACAGCTTGTGGAACTGG + Intergenic
1121012404 14:90528211-90528233 GGCTGGACAGAAGGAGGAGCTGG - Exonic
1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1123711551 15:22991440-22991462 GGCTTTGCAGCATGTGGAGCTGG + Intronic
1129127698 15:73458679-73458701 TCCTAGACAGCTTGTGGAGGAGG + Intronic
1129412675 15:75358676-75358698 GGCTGGGCAGCATGTGGGGATGG - Intronic
1131676748 15:94677748-94677770 AGCTGGACAGCTGGAGGAGATGG + Intergenic
1132666114 16:1082073-1082095 GGCTGGACAAGGTGGGGAGCAGG - Intergenic
1133233288 16:4376381-4376403 GGCGGGCCAGCATGAGGAGCGGG + Intronic
1134219402 16:12341800-12341822 GGCTGGGAAGCTTGGGGAGCAGG + Intronic
1136590379 16:31214759-31214781 GGCAGGACAGCTCCTGGTGCAGG - Exonic
1138448604 16:57079593-57079615 GGCAGGGCAGCTCGTGAAGCTGG - Exonic
1138454410 16:57113070-57113092 GGCTGGACAGCTTGTGGAGCAGG - Intronic
1139516470 16:67455181-67455203 GCCAGGACAGCGTGTGGAGGTGG - Intronic
1140210009 16:72962317-72962339 GGCTGGATAGTTTGTGGAAGAGG - Intronic
1142338723 16:89507499-89507521 AGCTGGAAAGCTTGTTGAGTAGG - Intronic
1142716313 17:1748793-1748815 GAGTGGACAGGCTGTGGAGCAGG + Intronic
1143501543 17:7342301-7342323 GGCTGTCCAGCTTGTGGTTCAGG - Exonic
1144679688 17:17184728-17184750 GACCGGACCGCTGGTGGAGCCGG - Intronic
1144786537 17:17835425-17835447 GGCTGGGAAGCTTCTGGGGCTGG + Intronic
1146828640 17:36047309-36047331 GGCTGGCCAGCTTGTGCTGGTGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147820382 17:43238045-43238067 GGCTGGACAGGTTGGACAGCAGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151380752 17:73724231-73724253 GGCTGGAGAGGGCGTGGAGCTGG + Intergenic
1151683950 17:75636094-75636116 GGCTGGGCAGCCTGGGCAGCAGG + Intronic
1152181215 17:78822918-78822940 GGCTGGAGAGCCTGGGGAGAGGG - Intronic
1152335620 17:79698993-79699015 AGCTGGACAGCTGGTGGCCCAGG - Intergenic
1154175590 18:12085988-12086010 GGCTGCACTCCTTGTTGAGCAGG - Intergenic
1156658612 18:39318372-39318394 TGCTGGAGAGGTTTTGGAGCTGG + Intergenic
1157444301 18:47733275-47733297 AGCTGGACACCTTTGGGAGCTGG - Intergenic
1157747310 18:50147164-50147186 GGCTGAGAAGCTTGTGGAACAGG - Intronic
1161007530 19:1943978-1944000 GGCAGGCCAGCATGTGGGGCTGG + Intronic
1162492728 19:11003484-11003506 GGCTGGGCATCTTGTGGGGCAGG + Intronic
1163223389 19:15937587-15937609 AGTTGCACAGCTGGTGGAGCCGG + Intergenic
1163702731 19:18794261-18794283 GGCTGGAGGGCTTGGTGAGCCGG + Intergenic
1165593151 19:36988377-36988399 TCCTGAACAGCCTGTGGAGCTGG - Intronic
1167706933 19:51086667-51086689 GGATGGACAGTGTGTGGAGAGGG + Intergenic
1168162845 19:54523575-54523597 AGCTTCACAGCTTGTGCAGCAGG + Intergenic
926165723 2:10521458-10521480 GGCTGGACGGCTTCAGCAGCAGG - Intergenic
928177394 2:29044161-29044183 GGCTGGATGGTTGGTGGAGCTGG + Intronic
934111782 2:88750172-88750194 GCCTGGACAACTTGTGGTGGGGG + Exonic
934295992 2:91743280-91743302 GGCTGGAGAGCCTGAGGAGCAGG + Intergenic
934928161 2:98396631-98396653 GGCAGGGCTGCTGGTGGAGCTGG + Exonic
936111768 2:109670879-109670901 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
937293419 2:120795698-120795720 GGCTGGACACCTGGAGGAGTGGG - Intronic
937396764 2:121543675-121543697 GGCTGGAGACCTTTTGGAGGGGG - Intronic
938098298 2:128477448-128477470 GGCTGGACAACTTAAGGAGAGGG + Intergenic
938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG + Intronic
938428467 2:131210785-131210807 GGCTGCACTCCTTGGGGAGCAGG - Intronic
938469369 2:131544803-131544825 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
939059691 2:137405757-137405779 GGCTTCACAGTTCGTGGAGCAGG - Exonic
942242964 2:173980545-173980567 GGCTTGATACCTTGTGGAGAAGG + Intergenic
942646067 2:178112404-178112426 GGCTGGACAGCGCCTGGCGCCGG + Intronic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
946374891 2:219302139-219302161 GGCTGCACAGCTGGGGAAGCAGG + Exonic
948342423 2:237265102-237265124 GGCTGGAGGCCTTGGGGAGCTGG - Intergenic
948391394 2:237613924-237613946 GGCTGGGAAGCTTGGGGAGGTGG + Intergenic
1168845062 20:938841-938863 GGCTGCACAGCCTTTGTAGCAGG - Intergenic
1169077326 20:2769243-2769265 GGCTGAACAAATTGTGGATCTGG - Intergenic
1172388898 20:34552830-34552852 GGATGGACTGGGTGTGGAGCAGG + Intronic
1173149158 20:40551033-40551055 GCCTGGACTCCATGTGGAGCTGG - Intergenic
1173180366 20:40802130-40802152 GGCTGGAAAGTTGATGGAGCAGG + Intergenic
1173858479 20:46266663-46266685 GGCTGGACGGCAAGTGGAGTAGG + Intronic
1173940356 20:46905676-46905698 GGCTGGGCAGCTCCTGGAGAGGG + Intronic
1174406573 20:50306812-50306834 AGGTGGACCGCATGTGGAGCAGG - Intergenic
1178738803 21:35177275-35177297 GTGTGGACATCTTGGGGAGCTGG + Intronic
1180697021 22:17758053-17758075 CACAGGCCAGCTTGTGGAGCCGG - Intronic
1180938942 22:19644384-19644406 GGCTGGACAGTGTGTGATGCTGG - Intergenic
1181174397 22:21027613-21027635 GGCTGGCCAGGTTTTGCAGCTGG + Exonic
1181618530 22:24071659-24071681 GGCTGGAAAGCGGCTGGAGCGGG - Intronic
1183159312 22:36101084-36101106 GGCAAGACAGCATGTGCAGCAGG - Intergenic
1184240907 22:43210855-43210877 GGCTGGGCAGGTTGTGGGGGCGG - Intronic
1184252703 22:43269756-43269778 GCTTGGACAGCTTGCGGAGTCGG - Intronic
1184718644 22:46296422-46296444 AGCTGCACAGCCTGTGGGGCTGG - Intergenic
1185344146 22:50304142-50304164 GGCTGGCCTGGCTGTGGAGCTGG - Intronic
950675142 3:14550158-14550180 GGCTGGTCAGTTTGGGGCGCAGG - Intergenic
950796019 3:15511366-15511388 GGCTGGACAGGCTTAGGAGCCGG - Intronic
950891257 3:16406535-16406557 GACTGGACAGCTTGTAAACCAGG - Intronic
952015973 3:28958516-28958538 GGCTGTACAAGTTATGGAGCCGG + Intergenic
952054191 3:29424514-29424536 GGCTGGACACATTATGGAGTTGG + Intronic
954121321 3:48501779-48501801 GCCTGGGCAGCTTCTGGAGGAGG - Intronic
954707340 3:52488137-52488159 GGCTGAACAGAGTGTGCAGCTGG - Exonic
956336470 3:68169828-68169850 GGCTGGGCAGCTTCAGCAGCTGG + Intronic
956390802 3:68770951-68770973 GGCTGGACATCAAGAGGAGCAGG + Intronic
958106598 3:89081835-89081857 TGCGAGACAGCTTGTGAAGCAGG - Intergenic
960053820 3:113262263-113262285 GGCTGGAGTGCTGGTGGAGGTGG + Intronic
960540297 3:118854556-118854578 GGTTGGAAAGCTTTTGGAGCTGG - Intergenic
960627530 3:119695566-119695588 TACTGGACAGTTTCTGGAGCAGG - Intergenic
961606371 3:128098519-128098541 GGCAGGGCAGTATGTGGAGCTGG + Intronic
962825363 3:139095971-139095993 GGCTGGACATGTTGGGGGGCTGG - Intronic
963069007 3:141287029-141287051 GGCAGCACAGGTTGGGGAGCCGG + Intronic
963645509 3:147908955-147908977 GACTGGGCAGCTTGAGGAACAGG + Intergenic
965818322 3:172659543-172659565 GGCTGCACAGCTAGGGGACCGGG - Intronic
966870913 3:184290329-184290351 GGCTGGGAGGCTTGCGGAGCTGG - Exonic
968569673 4:1332973-1332995 GGCTGGACAGGCTGTGTGGCTGG - Intronic
969879746 4:10163269-10163291 AGATTGACAGCTGGTGGAGCTGG + Intergenic
971341352 4:25772173-25772195 GGCTTGAAAGCTTGGAGAGCAGG + Intronic
972511306 4:39770704-39770726 GGGTGGCCACCTTGGGGAGCTGG - Intronic
973158103 4:46982891-46982913 GACTGGACAGATTGAGGGGCTGG + Intronic
973806039 4:54527145-54527167 GGCTGGAGAGGCTGTGGACCAGG + Intergenic
974514879 4:62896850-62896872 TGCTGCACACTTTGTGGAGCTGG + Intergenic
975494851 4:75026598-75026620 GGCTTGATAGTTTGGGGAGCAGG - Intronic
977331480 4:95642471-95642493 GGCTGGATACATTTTGGAGCAGG - Intergenic
980877942 4:138680762-138680784 GGCTGATCATTTTGTGGAGCTGG - Intergenic
985631189 5:1014928-1014950 GGCTTGACAGCCTCTGGACCCGG + Intronic
985976304 5:3420873-3420895 GTCTGGGCTGCTTGAGGAGCTGG - Intergenic
986449312 5:7850294-7850316 GGCTGGACAGCCTGTGGAGGGGG - Intronic
986761716 5:10885893-10885915 AGCTGGCCAGCATGTGGAGGTGG + Intergenic
986761825 5:10886976-10886998 GGCAGGAGAGCTTGTGCAGGGGG + Intergenic
988191285 5:27938799-27938821 GGCTGGAAAGGATGTGGACCTGG + Intergenic
990011555 5:51005144-51005166 GACTTGGCAGCTTGTGGAACGGG + Intergenic
991037773 5:62145088-62145110 GGCTGGGCTGCTTGTGTATCTGG + Intergenic
991416430 5:66397512-66397534 GGCTGAAGAGATTGTGGAGCAGG + Intergenic
995596883 5:113756885-113756907 GGCAGGACAACTTGAGAAGCAGG - Intergenic
996527249 5:124492202-124492224 GGCTGGACAGCTTGGTCAGAGGG - Intergenic
997712450 5:136017262-136017284 GCCTAGACATCTTGTGGAGAGGG + Intergenic
998497802 5:142605802-142605824 GGCTGAGCGGCTTGTGTAGCTGG + Intronic
999249933 5:150176510-150176532 GGCTGGAGGGCGTGTGGGGCAGG + Intronic
1001527087 5:172436739-172436761 GGCTACACAGCTTCTGCAGCGGG + Intronic
1002510866 5:179716263-179716285 GGCTTGACAGCTTCTGGATCTGG - Exonic
1002690315 5:181045806-181045828 GGCTGGAGAGATGGTGGAGGAGG - Intronic
1004540398 6:16544296-16544318 GGCTGGCCAAGTTGTGGCGCAGG + Intronic
1006136758 6:31900567-31900589 GGGTGGCCACCTTGGGGAGCTGG - Exonic
1006373729 6:33660246-33660268 GGCTGTCCAGCTAGGGGAGCAGG + Intronic
1006604426 6:35245856-35245878 GGCTGTACAGCTGGTGGTGGGGG - Intronic
1006609617 6:35286338-35286360 GGATGGTCAGCCTGTGCAGCTGG + Exonic
1006921998 6:37633384-37633406 CGCTGGGCAGCTTGAGGGGCTGG - Exonic
1007173057 6:39878086-39878108 GGCTGGACAGATTGGAGACCAGG + Intronic
1007490954 6:42221475-42221497 GTCTGGACAGCTCCTGGAACTGG + Intergenic
1012982704 6:105846861-105846883 GCCTGGCCACCTTGAGGAGCAGG + Intergenic
1019746425 7:2702750-2702772 AGCTGCACAGCTGGTGCAGCAGG - Exonic
1019758996 7:2795020-2795042 GGCGGGGCTGCCTGTGGAGCCGG - Exonic
1020381703 7:7554932-7554954 GGCAGCACAGCCTGAGGAGCTGG + Intergenic
1021387549 7:20050429-20050451 GGCTGGACAGCATATGGGACTGG - Intergenic
1025904177 7:65770901-65770923 GGCTGTACAGTTCCTGGAGCTGG + Intergenic
1028184661 7:87768519-87768541 AGGTGGTCAGCTTGTGCAGCTGG - Intronic
1029287432 7:99475505-99475527 GGCTTGTCAGCAGGTGGAGCTGG + Intronic
1029655726 7:101923152-101923174 GGCTGGACAGTTTGGAGACCAGG + Intronic
1029735544 7:102464041-102464063 GGCTGGAGAGGTTGTGGGGGGGG - Intronic
1030153527 7:106429026-106429048 AGCTGGACAGTGTGTGGACCTGG + Intergenic
1030737356 7:113065364-113065386 GGCAGGACAGCATGGTGAGCAGG + Intergenic
1034840018 7:154387032-154387054 GGCAGGACAGCATGTGGACCTGG + Intronic
1035416778 7:158695851-158695873 GGCTGCACAGCTTCTGCATCCGG - Intronic
1036918886 8:12832700-12832722 TCCTGGTCAGCTTGTGGAGGTGG - Intergenic
1039682987 8:39762785-39762807 GGCTGATCAGATTGTGGGGCTGG - Intronic
1040319381 8:46284948-46284970 GGCCTGACAGCTTTTGGAGCTGG - Intergenic
1041405767 8:57497569-57497591 GGCTGGACAACTTTTGGGTCAGG + Intergenic
1041838570 8:62244379-62244401 CACTGGAAAGCTTGTGGAGTGGG - Intergenic
1045594401 8:103635897-103635919 GGCTGGAGAGCTTGGGCAGGGGG + Intronic
1049799135 8:144509699-144509721 GGCTGTGCAGCTGCTGGAGCCGG + Exonic
1052794224 9:32908206-32908228 AGCTGGCAATCTTGTGGAGCTGG + Intergenic
1052963309 9:34319180-34319202 GGCTGGAGAGCTTGTGGGCCAGG - Intronic
1053286826 9:36855160-36855182 GGATGGCCAGCTGGTGGAGTCGG - Intronic
1053527950 9:38848608-38848630 GGCTGGCAAGGTTTTGGAGCAGG - Intergenic
1053904376 9:42826406-42826428 GGAAAGACAGGTTGTGGAGCGGG + Intergenic
1054200171 9:62073043-62073065 GGCTGGCAAGGTTTTGGAGCAGG - Intergenic
1054638184 9:67515317-67515339 GGCTGGCAAGGTTTTGGAGCAGG + Intergenic
1056732514 9:89178241-89178263 GGTGGGACACCTTGTGGAGCAGG + Exonic
1057604488 9:96489364-96489386 GGATGCACAGGTTGTGGAGGTGG - Intronic
1061963474 9:133999845-133999867 GGCTGGGCAGCGTGTGGAGGTGG + Intergenic
1062089951 9:134670628-134670650 CTCGGGACAGCCTGTGGAGCAGG - Intronic
1062402051 9:136377022-136377044 CCCTGGAAAGCATGTGGAGCTGG - Intronic
1185698060 X:2210773-2210795 GGCAGGACAGGTTGGGGGGCTGG - Intergenic
1187984989 X:24800534-24800556 CAGTGGACAGCTTGTAGAGCTGG - Intronic
1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG + Intronic
1189233474 X:39470178-39470200 ATCTGGACAGGTTGTGGAGAGGG - Intergenic
1189732862 X:44039859-44039881 GGCTTGACAGCTTGTGGGGAGGG - Intergenic
1190450548 X:50576075-50576097 GGCAGGACAGCTTGTTGTGGTGG + Intergenic
1190554303 X:51618265-51618287 CGCTGCACAGCTTCTGCAGCAGG - Intergenic
1190560598 X:51682223-51682245 CGCTGCACAGCTTCTGCAGCAGG - Intergenic
1190563693 X:51711098-51711120 CGCTGCACAGCTTCTGCAGCAGG + Intergenic
1191861459 X:65668848-65668870 GGCCAAACAGCTTGTTGAGCTGG + Intronic
1192588529 X:72340239-72340261 TGCCAGCCAGCTTGTGGAGCTGG + Intronic
1199853840 X:151743880-151743902 GGCTGGCCTGCTGGTAGAGCTGG + Exonic
1199861238 X:151801776-151801798 GGCTGCACACTGTGTGGAGCTGG - Intergenic
1201189642 Y:11436000-11436022 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
1201191679 Y:11448812-11448834 GGCTGGACAGCCTCTGGTTCAGG - Intergenic