ID: 1138454926

View in Genome Browser
Species Human (GRCh38)
Location 16:57115712-57115734
Sequence AGCCCCCACTGCATCATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138454926_1138454936 30 Left 1138454926 16:57115712-57115734 CCACAAATGATGCAGTGGGGGCT 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1138454936 16:57115765-57115787 CAGCAGCCCCCTCCCTGCACTGG 0: 1
1: 0
2: 12
3: 69
4: 499
1138454926_1138454930 -8 Left 1138454926 16:57115712-57115734 CCACAAATGATGCAGTGGGGGCT 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1138454930 16:57115727-57115749 TGGGGGCTGACAAGCTGGGGAGG 0: 1
1: 2
2: 7
3: 47
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138454926 Original CRISPR AGCCCCCACTGCATCATTTG TGG (reversed) Intronic
901301993 1:8206467-8206489 AAACGCAACTGCATCATTTGTGG - Intergenic
902650602 1:17834890-17834912 AGTCCCCACTGCATCCTGTAAGG + Intergenic
905867745 1:41385476-41385498 AGCCCCCACTGCCTCTGATGAGG + Intergenic
906682533 1:47739179-47739201 AGCCCCCAGTGAATCAGTAGTGG + Intergenic
916763284 1:167836002-167836024 AGTCCTCTCTGCATCATTTTGGG + Intronic
916893914 1:169141341-169141363 ATTCCCCACTTCATCTTTTGAGG - Intronic
923328552 1:232901632-232901654 AGCCCCTACTTCACCATTAGAGG - Intergenic
924931593 1:248737290-248737312 AGCCCCCACTGCGTTCTGTGAGG + Intronic
1064501138 10:15974633-15974655 AGCCCCCAAATCATCAGTTGTGG + Intergenic
1065934192 10:30506063-30506085 AATCCCCACTGCAGCACTTGTGG + Intergenic
1067016130 10:42757374-42757396 AGCCCCCTCTGCAGCCGTTGAGG + Intergenic
1070101247 10:73389125-73389147 TGCCCCCAGTGCATCATATCAGG - Intronic
1074311177 10:112324591-112324613 AGCCACCTCTTCATCCTTTGGGG + Intergenic
1075443799 10:122499903-122499925 AGAATCCACTGCATCATTTCTGG - Intronic
1076038187 10:127219118-127219140 AGTCCCCACTACTTAATTTGGGG - Intronic
1077138318 11:1012563-1012585 AGCCCCTTCTGCACCATCTGTGG - Intergenic
1077222615 11:1424300-1424322 ACCCCCTACTGCCTCATGTGGGG + Intronic
1077656856 11:4027802-4027824 AGCCCCTACAGGATCATATGAGG + Intronic
1078456085 11:11476653-11476675 AGCCCCCACTGTCTCTTTTCAGG + Intronic
1080497908 11:32838595-32838617 AGCCCCCACTAAAGCATTGGGGG - Intronic
1081776951 11:45682085-45682107 AGCCCCCACTTCAACATAAGAGG + Intergenic
1081936139 11:46905174-46905196 TGCCCCCACTCCATCCTTTCTGG + Intronic
1081962768 11:47150590-47150612 AGCCTCCACAGCATCTCTTGGGG - Intronic
1092911747 12:13151754-13151776 AGGCCACACTCCATCATTTCAGG + Intergenic
1102533967 12:113567324-113567346 AGCCACCACTGCATCATCTGTGG + Intergenic
1104442815 12:128808736-128808758 AGGCCCGACTGCAGCAGTTGTGG - Intronic
1104719617 12:131038114-131038136 CTCACTCACTGCATCATTTGGGG + Intronic
1105240152 13:18600736-18600758 AGCCCCAACAGCCTCAGTTGTGG - Intergenic
1107984865 13:45766910-45766932 AGCTCCCACAGCATCAAATGTGG + Intergenic
1108869923 13:54971989-54972011 AGCCCCTACTCCCTCACTTGAGG + Intergenic
1111413899 13:87913528-87913550 AGCCCCCAATGCACCCTTTGCGG + Intergenic
1111488474 13:88937231-88937253 AGCCCCCACTGGATCATACAAGG - Intergenic
1113516939 13:110910674-110910696 AGCCCACATTGCAGCCTTTGGGG - Exonic
1115101629 14:29708191-29708213 ACTCCCCATTGCCTCATTTGGGG - Intronic
1122794117 14:104197155-104197177 AGCCCCCACTTCATCCAGTGGGG - Intergenic
1123491080 15:20783349-20783371 AGCCCCAACAGCCTCAGTTGTGG + Intergenic
1123547582 15:21352440-21352462 AGCCCCAACAGCCTCAGTTGTGG + Intergenic
1123948318 15:25249602-25249624 ACCCCACACTGCCTCATTTATGG - Intergenic
1124721702 15:32116342-32116364 AGCCATCTCTGCATCATTTGTGG + Intronic
1125596704 15:40892005-40892027 TGTCCACACTGCATCATTAGGGG + Intergenic
1126865736 15:52934944-52934966 AGTTCCCACTGCATCATTGCAGG - Intergenic
1202955912 15_KI270727v1_random:79670-79692 AGCCCCAACAGCCTCAGTTGTGG + Intergenic
1134228270 16:12408886-12408908 AGCCCCCACTACTTCTATTGTGG + Intronic
1138454926 16:57115712-57115734 AGCCCCCACTGCATCATTTGTGG - Intronic
1140453781 16:75092747-75092769 AGCCCCCTCTGCCTCCTTTGTGG - Intronic
1142107117 16:88310093-88310115 TGCCCCCACTGCACCACTGGAGG - Intergenic
1142542002 17:667055-667077 AGCCCACAGGCCATCATTTGTGG - Intronic
1142678819 17:1533367-1533389 AGCCTCCACTTCCTCATCTGAGG + Intronic
1146129886 17:30262979-30263001 GGCCCCTAGAGCATCATTTGTGG - Intronic
1148665400 17:49371024-49371046 AGCCCTCAATTCATCCTTTGGGG + Intronic
1149420884 17:56510261-56510283 AGAGCCCACTACATAATTTGTGG + Intronic
1149493694 17:57103291-57103313 TGCCCCCACTTCATCACTTCAGG + Intronic
1152285306 17:79409331-79409353 AGCCCCCACTGCAGTCTTTTTGG + Intronic
1154448678 18:14458038-14458060 AGCCCCAACAGCCTCAGTTGTGG + Intergenic
1161120003 19:2520536-2520558 AGCCTCCTGTTCATCATTTGCGG + Intronic
1164561780 19:29297421-29297443 AGCCCACAGTGCATCATATAAGG + Intergenic
1164591047 19:29507169-29507191 AGCCGGCTCTGCACCATTTGGGG - Intergenic
1164732635 19:30517881-30517903 TGCCCCCATTCCATGATTTGGGG + Intronic
1164746596 19:30620611-30620633 AGCCACCACTGCAACACATGGGG - Intronic
1164889140 19:31808110-31808132 AGACCATACTGGATCATTTGAGG + Intergenic
927077055 2:19589127-19589149 TGCCCACACAGCATCATTTCAGG + Intergenic
930362134 2:50394587-50394609 AGCCACCACTGTCTCTTTTGTGG + Intronic
934561634 2:95316573-95316595 AGCCCACACAGCCTCATTTCAGG + Intronic
937921124 2:127132246-127132268 AGCCCACACTTCCACATTTGGGG + Intergenic
941254576 2:163212663-163212685 AGCTTACACTGCTTCATTTGAGG - Intergenic
942082564 2:172414867-172414889 TTCCCCCACTGCATCACTTCTGG + Intergenic
942111339 2:172685298-172685320 AGCTCCCACTGCCTCCATTGTGG - Intergenic
944542325 2:200765921-200765943 CCCCCAGACTGCATCATTTGGGG + Intergenic
945577337 2:211548549-211548571 AGCCCTGACTGCAACACTTGTGG - Intronic
1170609885 20:17903906-17903928 AGCCCCCACTCACTCCTTTGGGG - Intergenic
1172198711 20:33110363-33110385 AGTCCCCAGTGCATCCTTTCAGG + Intronic
1173181779 20:40811809-40811831 AGTCCTCACTGCACAATTTGGGG - Intergenic
1173750257 20:45470483-45470505 AGCCCGCGCTGCAGCACTTGAGG - Exonic
1175931122 20:62494211-62494233 AGGCCCCCCTGGATAATTTGGGG + Intergenic
1176447549 21:6832484-6832506 AGCCCCAACAGCCTCAATTGTGG - Intergenic
1176825718 21:13697510-13697532 AGCCCCAACAGCCTCAATTGTGG - Intergenic
1177555142 21:22679302-22679324 AGGCCCCACGGCAGCATCTGGGG - Intergenic
1181161317 22:20961641-20961663 AGCACCCACTGGATTCTTTGGGG - Intergenic
1181773076 22:25140727-25140749 TGCCCTCACTGCATCCTATGGGG - Intronic
1181887636 22:26034193-26034215 AGGGCCCACTGCATAATTTCTGG - Intergenic
1183175696 22:36223385-36223407 TGCCCACACTGCATCCTGTGAGG + Intergenic
950362482 3:12459486-12459508 AACCCCCACTGTGTGATTTGAGG + Intergenic
960375290 3:116893100-116893122 AGCCCACACTGCAGCATTCATGG + Intronic
961058708 3:123810489-123810511 AGCCCTCTCTGCTTCATTTCTGG + Intronic
967672692 3:192257566-192257588 AGCCACCACTGCACCATAAGTGG - Intronic
968805879 4:2772112-2772134 AGCCCCCACTGCAGCATGACGGG - Intergenic
971035643 4:22689869-22689891 GGCCCCCTCTGCTTCATTTTAGG - Intergenic
975147255 4:70982084-70982106 ACTCCACACTGCTTCATTTGAGG - Exonic
981080655 4:140636147-140636169 AGCCCACAGACCATCATTTGGGG + Intronic
985275421 4:188233406-188233428 AGCCCCCACCCCATTATTTCAGG - Intergenic
988563080 5:32298291-32298313 AGCCCCCACTGTGCCCTTTGTGG - Intronic
992679595 5:79140872-79140894 TGCCTTCACAGCATCATTTGTGG - Intronic
994414464 5:99450507-99450529 AGTCCCTCCTCCATCATTTGGGG + Intergenic
994898866 5:105744588-105744610 AGGCCCCACGGCAGCATCTGGGG - Intergenic
995451493 5:112306523-112306545 ATCCTCCACTGGGTCATTTGTGG - Intronic
995760451 5:115556345-115556367 AGATTCCACTGGATCATTTGTGG + Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001274280 5:170339049-170339071 TGCCCCCACTGCCTCACTAGAGG - Intergenic
1003244683 6:4374023-4374045 AACCCCCAGTGCCACATTTGGGG + Intergenic
1010881011 6:81171741-81171763 AGCACCCACTGCCTCTTTTTAGG - Intergenic
1016355375 6:143212437-143212459 AGCTCCCTCTGCATCACCTGTGG + Intronic
1018887949 6:167957177-167957199 TGCCCCCACTGCTTCATATGGGG + Intronic
1018977033 6:168573819-168573841 AGCCTCCACTGGATCGTTAGTGG - Intronic
1019306864 7:339770-339792 AGCCCCCAGTGAATGATTTCTGG - Intergenic
1019406622 7:887440-887462 AGCCCCCACTGGACCACTTCAGG - Exonic
1021041953 7:15873078-15873100 TGGCCCCACGGCAGCATTTGGGG - Intergenic
1021261844 7:18468050-18468072 TGTACCCTCTGCATCATTTGAGG - Intronic
1022582802 7:31573241-31573263 AACACCCACTACATCACTTGTGG - Intronic
1024941727 7:54769628-54769650 AGCTCCCATTGCATCTATTGAGG + Intergenic
1026281061 7:68922082-68922104 AGTCCCCACAGCAGCATCTGAGG - Intergenic
1027345817 7:77258326-77258348 AGTCACCCCTGCAGCATTTGAGG + Intronic
1030535146 7:110757364-110757386 AGAGTCAACTGCATCATTTGAGG - Intronic
1032665059 7:134027904-134027926 AGCCCTATCTGGATCATTTGTGG - Intronic
1034541038 7:151758307-151758329 AGCTACCACTGCATGATTTTAGG + Intronic
1040985790 8:53292705-53292727 AGCACCCAAAGTATCATTTGTGG - Intergenic
1041746333 8:61212401-61212423 AGCCCCCGCTGCATCTGCTGAGG - Intronic
1047220447 8:122914350-122914372 TCCCCCCACTTCACCATTTGTGG - Intronic
1047288694 8:123510311-123510333 GGCCCCAACTGCAGGATTTGAGG - Intronic
1047864726 8:129009888-129009910 TGCCCCCACTACACCATTAGAGG - Intergenic
1048020249 8:130531737-130531759 GGCCCCACCTGCAGCATTTGGGG - Intergenic
1048434182 8:134400465-134400487 AGCCCCACCTGGGTCATTTGTGG - Intergenic
1049569960 8:143364857-143364879 AGCCACCAATGCATCATCTGTGG - Intergenic
1049635984 8:143689686-143689708 AGCCTCCGCTGCCTCAGTTGCGG + Intronic
1053286197 9:36850952-36850974 TGCCCCCACAGCACCATTTTGGG - Intronic
1055352883 9:75407535-75407557 TGTCCCCTCTGCCTCATTTGGGG + Intergenic
1062004277 9:134231507-134231529 AGCCCCCACTGCCCCCTCTGAGG - Intergenic
1203521642 Un_GL000213v1:52047-52069 AGCCCCAACAGCCTCAATTGTGG + Intergenic
1190265011 X:48823042-48823064 AGTCACCTCGGCATCATTTGGGG + Exonic
1196322983 X:114365424-114365446 AGGCCCCACTGGAACATTTTGGG - Intergenic
1198577399 X:138025477-138025499 AGCCTCCACTGCACCATCTGAGG + Intergenic
1198800649 X:140444733-140444755 AGCCCCCACTGTATAACTTTTGG + Intergenic
1201537539 Y:15067399-15067421 TGGCCCCACAGCATCATCTGAGG + Intergenic