ID: 1138456189

View in Genome Browser
Species Human (GRCh38)
Location 16:57122117-57122139
Sequence CGCTGATGCCAGAGAGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138456189_1138456200 25 Left 1138456189 16:57122117-57122139 CCCTGTCCTCTCTGGCATCAGCG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 1138456200 16:57122165-57122187 GGGGCCACTGAGGCCCAGAAAGG 0: 1
1: 4
2: 61
3: 432
4: 2081
1138456189_1138456198 15 Left 1138456189 16:57122117-57122139 CCCTGTCCTCTCTGGCATCAGCG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 1138456198 16:57122155-57122177 TGGTACAGCCGGGGCCACTGAGG 0: 1
1: 0
2: 1
3: 13
4: 199
1138456189_1138456194 5 Left 1138456189 16:57122117-57122139 CCCTGTCCTCTCTGGCATCAGCG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 1138456194 16:57122145-57122167 GTGACTCCCATGGTACAGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 104
1138456189_1138456193 4 Left 1138456189 16:57122117-57122139 CCCTGTCCTCTCTGGCATCAGCG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 1138456193 16:57122144-57122166 TGTGACTCCCATGGTACAGCCGG 0: 1
1: 0
2: 2
3: 11
4: 124
1138456189_1138456192 -5 Left 1138456189 16:57122117-57122139 CCCTGTCCTCTCTGGCATCAGCG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 1138456192 16:57122135-57122157 CAGCGTCACTGTGACTCCCATGG 0: 1
1: 0
2: 0
3: 15
4: 165
1138456189_1138456195 6 Left 1138456189 16:57122117-57122139 CCCTGTCCTCTCTGGCATCAGCG 0: 1
1: 0
2: 1
3: 20
4: 225
Right 1138456195 16:57122146-57122168 TGACTCCCATGGTACAGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138456189 Original CRISPR CGCTGATGCCAGAGAGGACA GGG (reversed) Intronic
901068471 1:6505852-6505874 CGCTGGTGCAGGAGAGGACCCGG - Intronic
901573384 1:10180097-10180119 CGCTGAGACCTGAAAGGACATGG + Exonic
902606431 1:17571956-17571978 AGCTGATGCCAGAAATGAGATGG - Intronic
904418747 1:30378168-30378190 CGGTGTGGCCAGAGAGGCCAGGG + Intergenic
906384268 1:45353911-45353933 AGCTGATGCCAAAGAGGAACTGG + Intronic
908054105 1:60264477-60264499 CCCTCATGCCTGAAAGGACAAGG - Intergenic
912679504 1:111720216-111720238 TGTTGTTGCCAAAGAGGACAAGG + Intronic
915514124 1:156402713-156402735 AACTGAGGCCAGAGAGGAGAAGG - Intergenic
916491600 1:165306976-165306998 GGCTTCTGCCCGAGAGGACATGG - Intronic
918925492 1:190780507-190780529 AGATGATGCCAGAGAGGTAAAGG - Intergenic
919869620 1:201810620-201810642 CGCTGGGGCCCGAGAGGACGAGG - Exonic
922241290 1:223756925-223756947 AACTGAGGCCAGAGAGGAGAGGG + Intronic
923613015 1:235511988-235512010 CGCAGTTGCAAGAGAGGCCACGG - Intergenic
1062790147 10:298489-298511 AGCCCATGCCAGAGAGGAGAGGG + Intronic
1067164414 10:43853815-43853837 CTCTGATTCCAGTGAGGTCAGGG + Intergenic
1067299096 10:44993219-44993241 CACTGAGGCCAGACAGGGCAGGG - Intronic
1068581566 10:58746431-58746453 TGCTTCTGCCAAAGAGGACAGGG + Intronic
1069659682 10:70115346-70115368 TGCTGATGCCAGAGTGGAAATGG + Intronic
1070417314 10:76203230-76203252 AGCTGAGGCCAGAGAAGAGAAGG - Intronic
1070571666 10:77644357-77644379 CACTGATCACAGAGAGGAAAGGG - Intergenic
1070722161 10:78764327-78764349 AACTGAGGTCAGAGAGGACAGGG - Intergenic
1071458474 10:85869273-85869295 AGCTGATGCCAAAGAGGGCAAGG + Intronic
1071664599 10:87542381-87542403 GGCTTGTGCCAGAGAGGTCAAGG - Intronic
1073983763 10:109184491-109184513 AGCAGATGCTGGAGAGGACATGG - Intergenic
1075261307 10:120965690-120965712 GGCTCAGGCCACAGAGGACAGGG + Intergenic
1077611275 11:3644481-3644503 CCCTGAAGCCAGAGAGGAGGTGG - Intergenic
1078155272 11:8794633-8794655 TGATGATGCCAAGGAGGACAGGG + Intronic
1078321070 11:10335286-10335308 CGCTTGGGCCAGAGAGGTCAAGG - Intronic
1078844147 11:15106737-15106759 GGCTGATCCCAGAGACAACAAGG - Intergenic
1080305010 11:30826583-30826605 GCCTGATGCCAGAGATAACAAGG + Intergenic
1084274993 11:68046799-68046821 CACAGAAGCCAGAGAGGACAGGG - Intronic
1084582135 11:70030609-70030631 AGCTGATGACAGAGAGGACATGG - Intergenic
1085254150 11:75162985-75163007 CGCTCCTCCCAGAGAGGAAAGGG + Intronic
1087292713 11:96338035-96338057 CTCTGAAGCCAGAGATGACATGG + Intronic
1088355854 11:108943247-108943269 CCCTGATGTCAGAGAAAACAGGG - Intergenic
1089149689 11:116355221-116355243 AGCAGAAGCCAGAGAGGTCAGGG - Intergenic
1090479796 11:127057998-127058020 CCATGAGGCCACAGAGGACAAGG - Intergenic
1091285184 11:134404976-134404998 CACTGAGCCCAGAGAGGCCAAGG - Intronic
1092026547 12:5245592-5245614 CGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1092153713 12:6268610-6268632 AGCTGAGGTCAGAGGGGACAGGG + Intergenic
1093326229 12:17778216-17778238 ATCTGAAGCCAGATAGGACATGG + Intergenic
1097682142 12:62658801-62658823 CCCTGATGCCAAGGAGGAGATGG - Intronic
1100748425 12:97670841-97670863 AGAGGATGTCAGAGAGGACAAGG - Intergenic
1101968603 12:109296993-109297015 CACTGAGGCCAGAGAGGAACAGG + Intronic
1102001082 12:109558501-109558523 CACTGATGCCACAGAAGCCAGGG + Intronic
1103034661 12:117646850-117646872 TGCTGCTGACAGAGAGGACTTGG - Intronic
1104910611 12:132238486-132238508 TGCTGGTGCCAGAGAGACCACGG + Intronic
1106998800 13:35520517-35520539 TGCTGATGCTAGCGAGGAAAAGG + Intronic
1108066086 13:46578836-46578858 CCTTCATGCCAGAAAGGACAGGG + Intronic
1109510349 13:63363895-63363917 GGCTGCAGCAAGAGAGGACATGG + Intergenic
1112133225 13:96546987-96547009 CCCTGATGCCAGAAAGAAAATGG + Intronic
1113472142 13:110554791-110554813 CTCTGAGGCCAGAGAGGGCCTGG + Intronic
1114616086 14:24069167-24069189 CCCTGAAGCCCAAGAGGACACGG + Exonic
1115682184 14:35753089-35753111 AGCAGATTCCAGAGTGGACAAGG + Intronic
1119415575 14:74467301-74467323 CCCTTATGCTGGAGAGGACAGGG - Intergenic
1119859003 14:77923341-77923363 CCCTGAGGCCAGAAAGCACACGG + Intronic
1121248534 14:92482675-92482697 TGCAGAGGCCAGAGGGGACAAGG + Exonic
1121825845 14:97008725-97008747 CGCTGAGCCCAGAGAAGGCAAGG - Intergenic
1123940684 15:25215170-25215192 CACCGATCCCGGAGAGGACAGGG - Intergenic
1124650296 15:31469214-31469236 AGCAGGTGCCAGAGAGGAGAGGG + Intergenic
1125110384 15:36025607-36025629 CGGGGATGGCAGAGAGGACCAGG - Intergenic
1126358785 15:47823910-47823932 CCCAGAGGCCAGAGAGGACTGGG + Intergenic
1127274437 15:57429891-57429913 AGCTGAGCCCAGAGAGGTCAAGG - Intronic
1127388372 15:58485720-58485742 CGCTTATGCCACAAATGACAGGG - Intronic
1129191751 15:73941647-73941669 CCCTGAGGCCAGAGAGGAGACGG + Intronic
1129202755 15:74014784-74014806 CATTGAAGCCATAGAGGACAGGG + Intronic
1129696202 15:77741888-77741910 AGCTGAAACCAGAGAGGAGAGGG + Intronic
1130233660 15:82114886-82114908 GGGTGAGGCCAGAGATGACAGGG - Intergenic
1130301360 15:82681526-82681548 CACGGATGCTAGAGAGGACACGG + Exonic
1132717831 16:1301032-1301054 CGCTGGTGCCTCAGGGGACACGG - Intergenic
1133210850 16:4262697-4262719 CAAGGCTGCCAGAGAGGACAGGG + Exonic
1133317327 16:4892792-4892814 AGCTGATGCCAGGGGGGACGTGG - Intronic
1134886528 16:17798111-17798133 CACTGATGGCCGAGAGGCCAGGG - Intergenic
1135221937 16:20621478-20621500 CTGAGATGCCAGAGAGGCCAGGG - Intronic
1136063084 16:27740235-27740257 GGCTGGTGCCAGCGGGGACAAGG + Exonic
1137701946 16:50503704-50503726 GGCGGGTGCCAGGGAGGACAAGG + Intergenic
1137705450 16:50532688-50532710 GGCTCATGCCTGAGAGGCCAAGG - Intergenic
1138049978 16:53766307-53766329 CGCTGAAGCCTGGGAGGTCAAGG - Intronic
1138456189 16:57122117-57122139 CGCTGATGCCAGAGAGGACAGGG - Intronic
1140805524 16:78529035-78529057 CACTGGAGCCAGAGAGGTCAAGG - Intronic
1142136303 16:88453441-88453463 CGCGGAGGCCCGAGAGGCCACGG - Exonic
1142305805 16:89284757-89284779 CGCTGAAGCCAGTGAGGAAGAGG - Exonic
1143033705 17:3982476-3982498 CACTAAGGCCAGAGAGGGCAAGG - Intergenic
1143917050 17:10301812-10301834 CCCTGATGGCAGAGAGGGCAGGG + Intronic
1144771308 17:17761088-17761110 CTCTGAGCACAGAGAGGACAAGG - Intronic
1144788714 17:17845856-17845878 ATGTGCTGCCAGAGAGGACAGGG + Intronic
1145939337 17:28734332-28734354 CACTGGGACCAGAGAGGACAAGG - Intronic
1147345230 17:39787870-39787892 ACCTGAAGCCAGAGAGGAAATGG - Intronic
1148682322 17:49481627-49481649 TGCTGATGCCAGTGAGGGCAGGG - Intergenic
1148960630 17:51389711-51389733 AACTGAGGCCAGAGAGGAGAAGG + Intergenic
1151876380 17:76869903-76869925 CGCGGATGCCTGGGAGGAGAGGG - Intronic
1151985448 17:77540458-77540480 AGCTGATGGCAGTGGGGACAGGG - Intergenic
1152315068 17:79575363-79575385 CCCTGAGGCCAGGGAAGACAAGG + Intergenic
1153746414 18:8184433-8184455 CTCTGAAGGCACAGAGGACAGGG - Intronic
1153786720 18:8542046-8542068 CGCTGCAGCCAGGGAGGTCAAGG + Intergenic
1153807713 18:8723839-8723861 CACTGATACCTGATAGGACATGG + Intronic
1154009646 18:10564130-10564152 AGCTGAGCCCAGCGAGGACATGG - Intergenic
1154305223 18:13225531-13225553 AGCTGTTGACAGAGTGGACAGGG - Intronic
1157608783 18:48942950-48942972 GGATGAAGGCAGAGAGGACATGG - Intronic
1158289063 18:55918357-55918379 TGCTGATGCCAGAGGGTTCAAGG + Intergenic
1158341575 18:56472307-56472329 CTCTGATGCCAGAGGAGACACGG - Intergenic
1159441467 18:68485870-68485892 CCCTGATGCAAGAAAGGCCAAGG - Intergenic
1161128863 19:2576408-2576430 TGCTGACCCCAGGGAGGACAGGG + Intronic
1161399737 19:4061946-4061968 GGCTGATGGCAGGGTGGACAAGG - Intronic
1161549104 19:4901233-4901255 CGCTTATGCCAGAGAGGCTGGGG + Intronic
1161745635 19:6058030-6058052 TCCTGGTGCCAGAAAGGACATGG - Intronic
1162855887 19:13468391-13468413 CACTATTGCCAGAGAGGAAAAGG - Intronic
1163114610 19:15181369-15181391 CTCTGGTGCCTGAGAGGGCATGG - Intronic
1165108714 19:33488974-33488996 GGCTGATGCCATAGCAGACAAGG - Intronic
1165291620 19:34890425-34890447 CATTGATGCCAAAGTGGACACGG - Intergenic
1168113883 19:54209954-54209976 GGCTGAGGCCAGAGAGGGCAGGG + Intronic
1168181300 19:54664499-54664521 CACTGAGCTCAGAGAGGACAGGG - Intronic
925047945 2:788791-788813 CTCTGATGGCAGCCAGGACACGG + Intergenic
925069505 2:955890-955912 AGCTGGTGCCAGGGAGGCCAAGG + Intronic
926151164 2:10426295-10426317 CGCTGATGCCAGGGAGGATCCGG + Intronic
926219341 2:10924751-10924773 TGCTCCTGCCAGGGAGGACAAGG + Intergenic
929037793 2:37711379-37711401 TGCTGGTGATAGAGAGGACAAGG - Intronic
929318507 2:40511092-40511114 CTCTGATGACAGACATGACATGG - Intronic
931180708 2:59897713-59897735 CTCTGAAGCCACTGAGGACAGGG + Intergenic
932262412 2:70337721-70337743 AGCTGATCCCAGGGAGGTCAAGG + Intergenic
932337976 2:70941911-70941933 CACTGAAGCCAGAGTGGAGAAGG + Exonic
936007762 2:108905961-108905983 TGATGATGCCAGTGTGGACACGG + Intronic
936067774 2:109345018-109345040 TGCTGATACCAGTGAGGCCATGG + Intronic
937086961 2:119178133-119178155 TCCTGCTGCCAGAGAGGAGAAGG - Intergenic
937856096 2:126672878-126672900 CTCTGATTTCAGAGAGGAGAAGG - Intronic
938228125 2:129635430-129635452 CGCTGATGCTACAGTGGATATGG + Intergenic
938341654 2:130540134-130540156 CGCTGAGAACAGAGAGGACATGG + Exonic
938348175 2:130580575-130580597 CGCTGAGAACAGAGAGGACATGG - Intronic
938477799 2:131632135-131632157 AACAGATGCTAGAGAGGACATGG - Intergenic
941226407 2:162855414-162855436 AGCAGATGCTGGAGAGGACATGG - Intergenic
942112770 2:172698933-172698955 AGCTGATGCCAGAGATGCAAAGG + Intergenic
944585334 2:201167420-201167442 CCCTGAGCCCAGAGAGGTCAAGG + Exonic
946275553 2:218629130-218629152 CGCTTAAGCCTGAGAGGTCAAGG + Intronic
948460794 2:238129016-238129038 AGCTGAGGCCACAGAGGAGAGGG - Intronic
949075457 2:242055002-242055024 AGCTGATGTCAGAGGAGACAAGG + Intergenic
1169120159 20:3090911-3090933 CACTACTGCCAGAGAGGGCATGG + Intergenic
1169330310 20:4711026-4711048 CGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1170569444 20:17624725-17624747 AGCTGGTGTCAGACAGGACAGGG + Intronic
1170930087 20:20761920-20761942 CACTGAAGACACAGAGGACAGGG - Intergenic
1172057835 20:32166477-32166499 CCCAGAGGCCAGAGAGGGCAGGG - Exonic
1172702119 20:36860153-36860175 CGCTAAGGCCAGAGAGGGGAAGG - Intronic
1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG + Intergenic
1180470824 22:15653426-15653448 CACTTGTGCCAGAGAGGTCAAGG + Intergenic
1180625854 22:17192886-17192908 CCATGATGCCAAAGAGGAGATGG - Intronic
1180965585 22:19786551-19786573 TGATGATGCCAAAGATGACAGGG + Exonic
1181179018 22:21054457-21054479 GGCGGATGCCAGGGAGGTCACGG + Intronic
1183341992 22:37286629-37286651 GGCTGCTGGCAGAGAGGAGAAGG + Intronic
1183589033 22:38769357-38769379 AGATGAGGTCAGAGAGGACAGGG + Intronic
1184372410 22:44090807-44090829 CTATGATGCCAGCCAGGACATGG + Intronic
1184834840 22:47014972-47014994 CACAGGTGCCAGGGAGGACAGGG - Intronic
1184993174 22:48184202-48184224 AGGTGAAGGCAGAGAGGACATGG - Intergenic
1185117187 22:48944621-48944643 GGCTGATGGCAAAGGGGACAGGG - Intergenic
949539300 3:5019941-5019963 AGCTGTGGCCAGAGAGGAAAGGG - Intergenic
949774640 3:7619032-7619054 CCATCATGCTAGAGAGGACAAGG + Intronic
951505781 3:23443607-23443629 CGCAGATGCCATAGAGTACAAGG + Intronic
952784084 3:37135012-37135034 CCCTAGTGCCAGAGAGCACACGG + Intronic
954792569 3:53144076-53144098 CACTGAAGCCAGAGAGAAGAGGG - Intergenic
954803118 3:53198882-53198904 AGCTGAGGCCAGAGAGGAGAAGG + Intergenic
955112265 3:55960676-55960698 AGCTTGGGCCAGAGAGGACATGG - Intronic
957529870 3:81427320-81427342 TGCTGATTCCAGAGCGGGCAGGG - Intergenic
958164570 3:89862995-89863017 CGGTGCACCCAGAGAGGACATGG + Intergenic
964085985 3:152818897-152818919 CACCAATGCTAGAGAGGACATGG - Intergenic
966907934 3:184541300-184541322 CTCGGATGCCAGTGAAGACAGGG - Intronic
968584827 4:1411444-1411466 GGCAGAGGCCAGAGAGGGCAGGG - Intergenic
969238949 4:5887433-5887455 CGCTGATGCCAGGCAGGAACTGG + Intronic
969516101 4:7649025-7649047 CCCAGGTGCCAGAGAGGACGGGG - Intronic
969719465 4:8885298-8885320 CTGTGCTGCCAGAGGGGACAGGG + Intergenic
970715932 4:18922897-18922919 AGCTGATGTCAGAGATGGCAGGG + Intergenic
971384786 4:26132830-26132852 CCCTGATGCAAGAGGGGGCAGGG + Intergenic
971998090 4:33993375-33993397 TGCTCTTGCCTGAGAGGACAGGG + Intergenic
974428808 4:61770398-61770420 CGCAGGTCCTAGAGAGGACAGGG + Intronic
977143822 4:93410526-93410548 TGAAGATGCAAGAGAGGACAGGG - Intronic
978445360 4:108775324-108775346 AGCTGAAGCCAGGGAGGTCAAGG - Intergenic
978618059 4:110615119-110615141 CGCTGAGGCCAGTGAGGCCTGGG + Intergenic
980644100 4:135619223-135619245 CGGTGGTGGCAGAGTGGACAAGG + Intergenic
982356649 4:154476982-154477004 GACTCATGACAGAGAGGACAAGG + Intronic
982811723 4:159833866-159833888 AGCTGATGTCAGAGAGAAAATGG - Intergenic
984592956 4:181636908-181636930 GGCTGAGGTCAGAGAGGTCATGG - Intergenic
985175002 4:187191405-187191427 CTCAGATGCCAGTGAGGACCTGG - Intergenic
987338046 5:16914451-16914473 CACTGATCCCAGTGAGGTCATGG - Intronic
988135561 5:27166072-27166094 AACTGATGCTAGAGAGGATATGG - Intergenic
990047012 5:51445107-51445129 GGTGGATGCCAGAGTGGACAGGG - Intergenic
991664899 5:68989949-68989971 AGGTGATGACAGAGAGGAAAGGG - Intergenic
992423217 5:76627463-76627485 CGATGATGCCAACGTGGACAAGG + Exonic
992734231 5:79702900-79702922 TGCTACTGCCAGAGAGAACAAGG + Intronic
993940091 5:94047835-94047857 TGCAGATGCCAAAAAGGACAAGG + Intronic
995778098 5:115746728-115746750 CGCTGCTGCCAGAGGGAGCATGG + Intergenic
997440690 5:133906826-133906848 GGCTGAGGTCAGAGAGGCCAAGG - Intergenic
997997083 5:138595654-138595676 CTCTGCAGCCAGAGGGGACAGGG + Intergenic
998530127 5:142876691-142876713 CGCTTGTGCCAGGGAGGTCAAGG + Intronic
999246691 5:150158825-150158847 CGCTGAAGGCAGAGTGCACAAGG - Intergenic
1002629425 5:180560816-180560838 CGCTGAGGACACGGAGGACAGGG - Intronic
1002784571 6:391845-391867 GGCTGATACCAGAGAGGACCCGG + Intronic
1005092918 6:22078099-22078121 CTCTGATGCCATGGAGAACAGGG + Intergenic
1006986286 6:38177926-38177948 CCCTGATGCCACAGAGCTCACGG + Intronic
1007292511 6:40798282-40798304 TGCTGATGCCAGGGAGGAGCTGG + Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1008449389 6:51632617-51632639 CCATGAGGCCACAGAGGACAGGG + Exonic
1010384512 6:75263746-75263768 GGCTGATGCCAGATTGTACAGGG + Intronic
1010681244 6:78801750-78801772 AGCAGATGCTGGAGAGGACATGG - Intergenic
1011381926 6:86751216-86751238 CGCTGAGGACATAGAGGACTTGG + Intergenic
1011836185 6:91434080-91434102 CACTGATGCCAAAAAGGAGAGGG - Intergenic
1013246443 6:108291480-108291502 CTCTTAAGCCAGAGAGGTCAAGG + Intergenic
1016499962 6:144708931-144708953 CGTTCATGACAGAGAGGAGATGG + Intronic
1018219595 6:161565047-161565069 CCCAGATGAGAGAGAGGACAGGG - Intronic
1019167803 6:170110466-170110488 TGCTGATGCCAGCGAGCACTTGG - Intergenic
1020017960 7:4842486-4842508 CGCTGCTGGCAGAGAGGGCAGGG + Intronic
1020465376 7:8472651-8472673 CCCTAATGGCAGAGAGGAGATGG + Intronic
1022394459 7:29973513-29973535 AGCTGATGCAACTGAGGACAGGG + Intronic
1023454349 7:40322250-40322272 CTCTGAAGCCAGAAAGGAGAAGG - Intronic
1023754846 7:43407103-43407125 CCCTGCTGCCAGGGAGGGCAGGG - Intronic
1024222812 7:47301811-47301833 CCATGAAACCAGAGAGGACAGGG - Intronic
1025110903 7:56215398-56215420 AGCTGAGGCCAGGGAGGTCAGGG + Intergenic
1027224221 7:76233954-76233976 CTCTGAGGCCAGAGAGGGGAGGG + Intronic
1027956258 7:84882269-84882291 AGCAGATGCCAGAGTGGATAGGG + Intergenic
1029284452 7:99456189-99456211 CGCAGATGCAAGGGAGAACAAGG - Intronic
1030986472 7:116247098-116247120 CCATGATGGCAGAGAGCACATGG + Intronic
1032413979 7:131722165-131722187 CTCTGATGCTGGAGGGGACATGG + Intergenic
1034557686 7:151860398-151860420 CGTGGATGCCAGGGAGGAGAGGG - Intronic
1035957742 8:4101050-4101072 AGATGATGCCAGAGACGAGACGG + Intronic
1037584109 8:20264757-20264779 CCCTGAGGCCAGAGCGGAAAAGG + Intronic
1037916229 8:22775096-22775118 AACTGATGCCAGAGAGGCAACGG - Intronic
1038495771 8:28001144-28001166 CGCTTAAGCCTGAGAGGTCAAGG - Intergenic
1038913222 8:31990733-31990755 CCCTGATCCCAGATTGGACAAGG + Intronic
1041036790 8:53799800-53799822 CTCAGATGGCAGAGGGGACAGGG - Intronic
1042219110 8:66455854-66455876 CGCTTAAGCCAGGGAGGTCAAGG + Intronic
1042229887 8:66544691-66544713 GGGTGATGTCAGAGATGACAAGG + Intergenic
1044729884 8:95221183-95221205 AGCAGAAGCCAGAGAGGAAAGGG - Intergenic
1047120496 8:121898558-121898580 CGCTTGAGCCAGAGAGGTCAAGG + Intergenic
1048341901 8:133546676-133546698 GGCTGAGGCCAGATAGGAAAGGG + Intronic
1049554402 8:143274916-143274938 AGCTGATGCCAGGGAAGAAAAGG - Intronic
1050358435 9:4804728-4804750 GGCTGACGCCAGCGAGGACACGG + Intronic
1051292737 9:15561774-15561796 CCCTGATGACACAGAGAACAAGG - Intronic
1052217800 9:25988075-25988097 CACAGATGCTAGAGAGGATATGG + Intergenic
1059426110 9:114222026-114222048 AGCTGATGGCAGAGAGGGGATGG + Intronic
1059448127 9:114351745-114351767 CGCTTGGGCCAGGGAGGACAAGG + Intronic
1061309431 9:129752687-129752709 CTCTTAAGCCAGAGAGGAGAAGG + Intronic
1062134017 9:134915231-134915253 CGCTGCTGCCAGGGAGGATCCGG + Intronic
1062318909 9:135981000-135981022 CGCTGATGCCAGCCTGGCCATGG - Intergenic
1185713999 X:2326725-2326747 CTTTGAGGGCAGAGAGGACACGG - Intronic
1189178609 X:38982432-38982454 AGCTGATCCCAGAGAGGTCAGGG - Intergenic
1190218373 X:48495003-48495025 ATCTGATGCCAGGGAGGTCAAGG + Intergenic
1192048488 X:67701431-67701453 GGCTGAAGCCAGAGAGGGCAAGG - Intronic
1192340415 X:70259234-70259256 CGCTGATGCAGGTGAGGAAAAGG + Exonic
1197750572 X:129961119-129961141 CGCTGAAGCCCCAGAGGAGAGGG - Intergenic
1198494479 X:137177707-137177729 GACAGATGCCAGAGAGAACATGG + Intergenic
1201188904 Y:11430037-11430059 CGCTGAAGCCAGCGACGACTCGG - Intergenic