ID: 1138457193

View in Genome Browser
Species Human (GRCh38)
Location 16:57127962-57127984
Sequence CTCGGGGATCAGCTCTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138457182_1138457193 25 Left 1138457182 16:57127914-57127936 CCGGAGTTAGTTTCCTTTTGGTT 0: 1
1: 0
2: 0
3: 31
4: 310
Right 1138457193 16:57127962-57127984 CTCGGGGATCAGCTCTGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 106
1138457186_1138457193 12 Left 1138457186 16:57127927-57127949 CCTTTTGGTTGAGATGGGGTTTG 0: 1
1: 0
2: 4
3: 49
4: 336
Right 1138457193 16:57127962-57127984 CTCGGGGATCAGCTCTGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138457193 Original CRISPR CTCGGGGATCAGCTCTGGAA AGG Intronic
903041871 1:20536798-20536820 CTGGGGGGTCAGCTCTGACACGG - Intergenic
903678903 1:25083919-25083941 CTCTGAGATTAGCTCTGGACCGG + Intergenic
903811819 1:26038910-26038932 CTCCTGGGCCAGCTCTGGAAGGG - Exonic
904378135 1:30094519-30094541 GTCGGGGCTGAGCTCTGGAGGGG + Intergenic
905417663 1:37815406-37815428 CTGGGGGCTCGGCTCTGGAGGGG + Exonic
907311324 1:53540691-53540713 CTCGGGGTGAAGCTCAGGAAAGG - Intronic
910633983 1:89386810-89386832 CAGGGGGTTCAGTTCTGGAAAGG - Intergenic
912571940 1:110631178-110631200 CCCGGGGATCAGTAATGGAATGG - Intronic
916404648 1:164485989-164486011 ATCTGGGAGCAGCTCTGGGATGG - Intergenic
920436415 1:205949877-205949899 CTCAGTGATCAGTTCTGGCAAGG - Intergenic
1063135352 10:3211811-3211833 CCAGGGGATCAGCTCTGAGAAGG + Intergenic
1064054031 10:12082313-12082335 GGCGGGTATCAGCTTTGGAATGG - Intronic
1067849278 10:49744575-49744597 CACTGGGATCAGGACTGGAATGG - Intronic
1073888670 10:108071294-108071316 ATTTGGGATCAGTTCTGGAAGGG + Intergenic
1075258900 10:120946083-120946105 CTCGGGGGTCAGCTCTAGTCAGG - Intergenic
1076360495 10:129885250-129885272 GGCGGGGATCTGTTCTGGAAGGG - Intronic
1077207087 11:1349892-1349914 CTCTGGGAACAGCTGGGGAAAGG - Intergenic
1080605175 11:33859636-33859658 CTCGGGGATGAGCCCTAGAAAGG + Intronic
1081675215 11:44964706-44964728 CGGGGTGATCAGCTCTGCAAAGG + Intergenic
1084529130 11:69716871-69716893 CTCTGGGCTCAGCTCTGGCTAGG + Intergenic
1088611318 11:111580000-111580022 CTCGGCAATCAGCTCTGGAGGGG + Intergenic
1092365186 12:7871682-7871704 CTTGGGGAGCAGCCCAGGAATGG - Intronic
1092536612 12:9395008-9395030 TTCTGGTTTCAGCTCTGGAAGGG + Intergenic
1092558063 12:9578316-9578338 TTCTGGTTTCAGCTCTGGAAGGG - Intergenic
1094513235 12:31109601-31109623 TTCTGGTTTCAGCTCTGGAAGGG + Intergenic
1104973503 12:132541881-132541903 TGGGGGGAGCAGCTCTGGAAGGG - Intronic
1105639881 13:22251598-22251620 CTCACGGATGAGCTCTGGAGAGG + Intergenic
1105892381 13:24690806-24690828 CTCTGGGATGAGCTTTGTAACGG - Intronic
1108726620 13:53190282-53190304 CTCGGAGAGCAGCTATGGAGGGG + Intergenic
1110623472 13:77625048-77625070 CTCTGGCATTAGCACTGGAAGGG + Intronic
1111078364 13:83268601-83268623 CCCCGTGCTCAGCTCTGGAATGG - Intergenic
1111843942 13:93485861-93485883 CTCAGGGAAGAGATCTGGAATGG + Intronic
1113454044 13:110434830-110434852 CTCAGGGACCAGCCCTGGTAGGG + Intronic
1117556625 14:56893008-56893030 CTTGGGGACCAGCTGAGGAAGGG - Intergenic
1122806970 14:104264712-104264734 CTTGGGGATGAGCTCCGGACAGG + Intergenic
1125475941 15:40048075-40048097 CTCTGAGCTCAGCTCTGTAAGGG + Intergenic
1127262666 15:57337423-57337445 CTCCGGGCTCAGCTCTGGAGGGG + Intergenic
1128866787 15:71120406-71120428 CTCAGTGATCAGCTTCGGAAAGG - Intronic
1131178927 15:90227442-90227464 GTGGGGAATCAGCTCAGGAAAGG + Intronic
1131558378 15:93418555-93418577 CCAGTGGATCAGCTCTGGGAAGG + Intergenic
1135008202 16:18847546-18847568 CTCTGGGATGAGCTCTGGCTGGG - Exonic
1138457193 16:57127962-57127984 CTCGGGGATCAGCTCTGGAAAGG + Intronic
1139502118 16:67375355-67375377 CTTGTGGATAAGCACTGGAATGG + Exonic
1140376162 16:74446948-74446970 CTCAGGGAGGAGGTCTGGAAAGG + Intergenic
1147448390 17:40488832-40488854 CTCGGGGGACGTCTCTGGAAAGG + Exonic
1148253258 17:46105204-46105226 CTGGAGGAGCTGCTCTGGAATGG - Intronic
1152912156 17:83011013-83011035 AACAGAGATCAGCTCTGGAAAGG + Intronic
1155059222 18:22213666-22213688 CTCTGGGCTCAGCTCTGTCATGG + Intergenic
1159746328 18:72240412-72240434 CTTGGCAATGAGCTCTGGAAAGG - Intergenic
1160964871 19:1742921-1742943 TTGGGGGATCAGATCTGGGAGGG - Intergenic
1162319154 19:9960547-9960569 CTCTGGGGACAGCTCCGGAAAGG - Exonic
1163103499 19:15110606-15110628 CGCGGGGCTCAGCTGTGGCAGGG - Exonic
1163512074 19:17741369-17741391 CTGGGGGATCAGCACTGGCTTGG + Intergenic
1163625708 19:18388334-18388356 CTCGGGGAGCCCCTCGGGAAGGG - Exonic
1166807006 19:45493362-45493384 CTCCAGGAACAGCTATGGAATGG - Exonic
928096680 2:28409229-28409251 CTCGGGAAGCAGCCCTGGATGGG - Intronic
929693058 2:44090556-44090578 CTGGGGGATCACCTCTGGGCTGG + Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
930430370 2:51267829-51267851 CTCAGTGAAAAGCTCTGGAAGGG + Intergenic
930949846 2:57127162-57127184 CCCAGGGATCAGCTAGGGAAAGG + Intergenic
931221882 2:60295706-60295728 CTCCTGGATCTGTTCTGGAAGGG + Intergenic
932278975 2:70473130-70473152 CTCTGGACTCAGCTCTGGGATGG + Intronic
932567037 2:72916971-72916993 CACGGGGGACAGCTCTGGAAAGG - Intronic
933864921 2:86507695-86507717 CTCGTGTGTCAGCTCTTGAAAGG - Intronic
935011537 2:99141124-99141146 CGCGGGGATGAGCTCTGGGCAGG - Intronic
936042515 2:109160728-109160750 CTCTGGGAGCTGGTCTGGAAGGG + Intronic
942315356 2:174692459-174692481 CTCGAGGATGGGTTCTGGAATGG - Intergenic
946268624 2:218569961-218569983 CACGGGGATCAGGGCTGTAAAGG - Intronic
947833414 2:233158197-233158219 CTCGGGGCTCAGCTTGGGGACGG + Intronic
948445679 2:238031052-238031074 CTAGGGGAACAGCACAGGAAGGG + Intronic
1172094632 20:32454617-32454639 CTCGGGGCACCGCTCTGGGACGG + Intronic
1172274592 20:33672816-33672838 CTCGGGGCTCAGGTCTAGGACGG - Intronic
1172658196 20:36549539-36549561 CTCGGGGAACAGCCCCGGAATGG - Exonic
1181078299 22:20395823-20395845 CACGTGGAGCAGCTCAGGAAGGG + Intronic
1181803433 22:25361516-25361538 CCCAGGGATCAGCTGTGGACGGG + Exonic
1183269197 22:36850142-36850164 CTCGGGGAACAGCTAGGGAGAGG + Intergenic
1184438825 22:44496700-44496722 CTCGGGGAACACGTCTGGAGAGG + Exonic
950264783 3:11565531-11565553 CTTGGGGTTCTGGTCTGGAAAGG - Intronic
953476816 3:43212261-43212283 CTCTTGAATGAGCTCTGGAAGGG + Intergenic
968959054 4:3733626-3733648 CTCCGGGCTCCGCTCTGGAGAGG - Intergenic
969704620 4:8785009-8785031 CTGGGGGAGCAGCTCTGGTGGGG - Intergenic
973638499 4:52881276-52881298 TTCGGGGATCAGCTGTTCAAAGG - Intronic
981180020 4:141730700-141730722 CTGGGGAATCAGCTGTGCAATGG + Intronic
982195966 4:152914409-152914431 GTCTGGTATCAGCTCTGGTAGGG + Intronic
996976323 5:129439154-129439176 CTTAGGGATCTGCTGTGGAATGG - Intergenic
1000197708 5:158975739-158975761 CTGGGGGGTCAGAGCTGGAAGGG + Intronic
1002277975 5:178115404-178115426 CTGGGGGATCAGCTCTGCTAAGG - Intronic
1002422052 5:179153987-179154009 CCCTGGGGTCAGCTCTGGGAGGG - Intronic
1002560935 5:180081614-180081636 CTCTGGTGTCAGCTCTGGACTGG - Intergenic
1004637640 6:17484199-17484221 ATCAGGGAAGAGCTCTGGAAAGG - Intronic
1007384361 6:41510620-41510642 CTCATGGAGCAGCTCAGGAATGG - Intergenic
1008816852 6:55578982-55579004 CTCCGGGAGCATCTCTGGATCGG - Exonic
1017010888 6:150063434-150063456 CTGGGGGAGAAGCTCTGAAATGG - Intronic
1018277471 6:162148306-162148328 CTCGTGATTCAGCTCTGCAAAGG + Intronic
1019297329 7:285072-285094 CCTGGGGAGGAGCTCTGGAAGGG + Intergenic
1019776221 7:2913453-2913475 CTCAGGGTCCAGCTCTGGCAGGG + Exonic
1023230714 7:38025216-38025238 CTGGGGGCCCAGCTCTGGGAGGG - Intronic
1023665985 7:42523997-42524019 CTCAGGGATGAGATCTGGACTGG - Intergenic
1026173917 7:67978886-67978908 CTCTGGGAAAAGCTCAGGAAAGG - Intergenic
1027772791 7:82428456-82428478 CTAGGGGAAAATCTCTGGAATGG - Intronic
1033039869 7:137908296-137908318 CCCGGGGTGCAGCTCTGGAGGGG + Exonic
1034979718 7:155468007-155468029 CGCGGGGCTCAGCCCTGGAGGGG - Intergenic
1035078829 7:156199429-156199451 CCCAGGAACCAGCTCTGGAAGGG - Intergenic
1037768895 8:21787670-21787692 CTCGGGGAGCAGACCAGGAAAGG + Intronic
1041390930 8:57347090-57347112 CTTGGGGGTCAGAGCTGGAAAGG - Intergenic
1043583670 8:81741594-81741616 TTTGGGGGTCAGCTTTGGAATGG + Intronic
1048796271 8:138152767-138152789 CCAGGGGTTCAGCTCTGGAGGGG + Exonic
1049621649 8:143600932-143600954 CTCGGGCAGCATCTCTGCAAAGG - Exonic
1060024853 9:120162292-120162314 AGCAGGGACCAGCTCTGGAAAGG - Intergenic
1060424474 9:123493120-123493142 CTTGAGGATCAGCTCTTGCAAGG - Intronic
1060517729 9:124276273-124276295 CTCAGGAATCATCTCTGGATGGG + Intronic
1061096508 9:128460277-128460299 GTCTGGGATCTGTTCTGGAACGG + Intronic
1062393219 9:136342299-136342321 GGCTGGGAGCAGCTCTGGAAAGG + Intronic