ID: 1138459308

View in Genome Browser
Species Human (GRCh38)
Location 16:57138599-57138621
Sequence ACTCTGCAAGGCCCTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 204}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138459299_1138459308 7 Left 1138459299 16:57138569-57138591 CCTAGCTGTTCCCCCGCAGGTCC 0: 1
1: 0
2: 2
3: 13
4: 154
Right 1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1138459294_1138459308 29 Left 1138459294 16:57138547-57138569 CCCCGTGTGTTCCTCGAGCACTC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1138459293_1138459308 30 Left 1138459293 16:57138546-57138568 CCCCCGTGTGTTCCTCGAGCACT 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1138459304_1138459308 -6 Left 1138459304 16:57138582-57138604 CCGCAGGTCCTTCCTGGACTCTG 0: 1
1: 0
2: 5
3: 53
4: 393
Right 1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1138459296_1138459308 27 Left 1138459296 16:57138549-57138571 CCGTGTGTTCCTCGAGCACTCCT 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1138459295_1138459308 28 Left 1138459295 16:57138548-57138570 CCCGTGTGTTCCTCGAGCACTCC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1138459297_1138459308 18 Left 1138459297 16:57138558-57138580 CCTCGAGCACTCCTAGCTGTTCC 0: 1
1: 0
2: 0
3: 11
4: 77
Right 1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1138459302_1138459308 -4 Left 1138459302 16:57138580-57138602 CCCCGCAGGTCCTTCCTGGACTC 0: 1
1: 0
2: 5
3: 10
4: 168
Right 1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1138459303_1138459308 -5 Left 1138459303 16:57138581-57138603 CCCGCAGGTCCTTCCTGGACTCT 0: 1
1: 0
2: 2
3: 42
4: 337
Right 1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1138459301_1138459308 -3 Left 1138459301 16:57138579-57138601 CCCCCGCAGGTCCTTCCTGGACT 0: 1
1: 0
2: 2
3: 13
4: 202
Right 1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG 0: 1
1: 0
2: 0
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138459308 Original CRISPR ACTCTGCAAGGCCCTCCCTC AGG Intronic
902659442 1:17891035-17891057 GCTTGGCAAAGCCCTCCCTCTGG + Intergenic
903278397 1:22236219-22236241 ATTCTGCCCGGCCCTCCCTAGGG + Intergenic
903337829 1:22636717-22636739 ACTCTGCAGCCCCCTCCCTCTGG - Intronic
904431640 1:30468324-30468346 ACTCTCCAAGGCCTTCCCTTTGG + Intergenic
904483364 1:30807627-30807649 ATCCTGCCAGGCCCTGCCTCGGG + Intergenic
905550374 1:38833202-38833224 ACTGACCAAGGCCCTCCCTAAGG + Intergenic
907028532 1:51147662-51147684 ACTCTCCAATGCCTTCTCTCGGG + Exonic
907964942 1:59319843-59319865 CCTCTGCTAGGCCCTCTCTCAGG - Intronic
908648627 1:66307630-66307652 CCTCAGCAAGGCCCTCAATCTGG - Intronic
910184466 1:84522417-84522439 ACTCACCAAGACGCTCCCTCAGG - Intergenic
910294291 1:85628895-85628917 GCTGTGCAGGGCCCTCTCTCCGG + Intergenic
913333644 1:117687475-117687497 ACTCTGCAAGGACGACCCACAGG - Intergenic
914832653 1:151181843-151181865 CCTCCGCCATGCCCTCCCTCTGG + Intronic
916294109 1:163197813-163197835 GCTCTGCTAGGACCTCTCTCAGG + Intronic
916518846 1:165545041-165545063 ACTCTGCAGGGCCCACCCTTGGG + Intronic
920038426 1:203080655-203080677 AGTCTTCCAGGCCCACCCTCAGG + Intergenic
922021849 1:221713296-221713318 ACTCTGCATGCCACTTCCTCCGG - Intronic
922199082 1:223386083-223386105 TCTCTGCACGGCCATACCTCTGG - Intergenic
922946859 1:229523749-229523771 ATTCTGCATGTCCTTCCCTCTGG - Intronic
924551243 1:245079854-245079876 ACTCTGCAACTCCCCACCTCAGG - Intronic
1069624490 10:69859520-69859542 CCTGTGCAAGGCCCTGCCTGGGG - Intronic
1070312277 10:75282495-75282517 GCTCTGGATGGCCCTGCCTCTGG + Intergenic
1070672459 10:78387725-78387747 CCTCTGTGAGTCCCTCCCTCAGG - Intergenic
1072733772 10:97865733-97865755 GGTCTGCAAGGCCCTCACTCCGG - Exonic
1073449178 10:103599458-103599480 AGGCTGCAGGGCCCTCCCCCTGG + Exonic
1074770307 10:116729288-116729310 ACCCTGAAAGTCCCTCCCTTTGG + Intronic
1075153523 10:119955841-119955863 TCTCTGAAAGGCCATCCCACTGG - Intergenic
1075729916 10:124630007-124630029 GCTCTGCAGGGCCCTTCCCCTGG + Intronic
1076377436 10:130001103-130001125 ACATTGCAAGGCCCTCTCCCTGG + Intergenic
1076417270 10:130300821-130300843 AGCCTGCAAGGCCCACCTTCCGG + Intergenic
1076680056 10:132167220-132167242 ACACTGGAAGTCCCTCCCTGGGG + Intronic
1077424249 11:2467017-2467039 CCCCTGGAAGGCACTCCCTCAGG - Intronic
1077444825 11:2586078-2586100 ACCCGGCAACGCCCACCCTCTGG - Intronic
1078445652 11:11403180-11403202 ACTGTGGAAGGCCCTTCCTGTGG - Intronic
1078933492 11:15931002-15931024 ACTCTGAAAAGCCCTCCCACTGG + Intergenic
1081746098 11:45473493-45473515 CCTCTGCAGGGCCCTCCCCATGG - Intergenic
1081857452 11:46312719-46312741 CCTCCCCTAGGCCCTCCCTCAGG + Intronic
1082027349 11:47582496-47582518 TCTCTGCAAGTCCCTCCCTGAGG - Intronic
1083602276 11:63956143-63956165 AAGCTGCAAGGCCCTCTCTAAGG - Exonic
1084774125 11:71364421-71364443 ACTCTGCTAGGACCTACCACAGG - Intergenic
1085473547 11:76773491-76773513 TCTCAGCCAGGCCCTCCCTCAGG + Intergenic
1085527029 11:77170276-77170298 TCCCTGCAAAGCCCTTCCTCTGG - Intronic
1089396415 11:118138945-118138967 CCACTCCAAGGACCTCCCTCAGG + Intronic
1089681098 11:120119404-120119426 CCTGTGCAAAGCCCTCCCACAGG + Intronic
1091136826 11:133198777-133198799 CCTCTGCCAGGCCCTCCCTAAGG - Intronic
1092151157 12:6249824-6249846 ACTCTGCAGAGCCCCTCCTCTGG - Intergenic
1092241055 12:6836907-6836929 GGGCTGCAAGACCCTCCCTCCGG - Intronic
1096378769 12:51137471-51137493 AATCAGCAAAGCCCTACCTCAGG + Intronic
1096555039 12:52398634-52398656 ACTCTGGCTGGCCCTTCCTCTGG - Intronic
1096669978 12:53192793-53192815 CCACTGCAGAGCCCTCCCTCGGG + Exonic
1099160401 12:79234138-79234160 ACTCTCCAAGCCTCTGCCTCTGG + Intronic
1102348501 12:112174940-112174962 ACCCTGCCCTGCCCTCCCTCTGG - Intronic
1102950045 12:117025395-117025417 ACAGGGCAAGGCCCTCCCACAGG + Intronic
1104697642 12:130875643-130875665 ACTTTGAAAAGCCCTTCCTCTGG + Exonic
1104726982 12:131084293-131084315 AGGAAGCAAGGCCCTCCCTCTGG - Intronic
1104975141 12:132548833-132548855 CCTCTGCAGGGCCGTCCCTGAGG - Intronic
1107195790 13:37649657-37649679 ACTCTGCAAGCTCCGCCTTCCGG - Intronic
1114010643 14:18363543-18363565 ACTCAGAAAGGCCTTGCCTCGGG - Intergenic
1117211743 14:53507783-53507805 AACCTGCAAGGCTCTGCCTCTGG - Intergenic
1119734793 14:76974994-76975016 ACTGAGCAAGGCCCTGCCCCAGG - Intergenic
1121199197 14:92103664-92103686 TCTGTGCCAGGCCCTCTCTCAGG + Intronic
1121685508 14:95832313-95832335 ACACAGCAAGCCCCTCCCCCAGG + Intergenic
1122717064 14:103702206-103702228 TCTCTGCAAGGCCCTGCCATAGG + Intronic
1123066086 14:105620161-105620183 GTTCTGGAAGGCCCTCCCTGTGG + Intergenic
1123070230 14:105639214-105639236 GTTCTGGAAGGCCCTCCCTGTGG + Intergenic
1123074820 14:105662873-105662895 GTTCTGGAAGGCCCTCCCTGTGG + Intergenic
1123089467 14:105735998-105736020 GTTCTGGAAGGCCCTCCCTGTGG + Intergenic
1123095255 14:105764158-105764180 GTTCTGGAAGGCCCTCCCTGTGG + Intergenic
1124580923 15:30954172-30954194 CCCCTGCAAGGCCCTCCCCCAGG + Intronic
1125510258 15:40288894-40288916 ACTCTGCCAGCGCCTCCTTCTGG + Exonic
1125712083 15:41795244-41795266 AGTCTGGAAGGCCCTCTCTGAGG + Intronic
1128501765 15:68231575-68231597 GCACTGCATGCCCCTCCCTCTGG - Intronic
1129169172 15:73797471-73797493 ACTCTGAGAGCTCCTCCCTCAGG - Intergenic
1132045149 15:98557526-98557548 CCTCTGCCAGGCCTTCCGTCTGG - Intergenic
1132699803 16:1217518-1217540 TCCCTGCAGGGCCCTCCCCCGGG + Intronic
1133346750 16:5076183-5076205 ACTCTGCACGGCCAGCCTTCAGG + Intronic
1134875835 16:17697772-17697794 ACCCTCCATTGCCCTCCCTCTGG - Intergenic
1135104147 16:19632776-19632798 CCTGTCCCAGGCCCTCCCTCAGG - Intronic
1135424854 16:22327314-22327336 ACTCTGCCAGTACCTCCCACAGG - Intronic
1137728601 16:50673589-50673611 GCGCTGCAGGGCCCTCTCTCCGG + Exonic
1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG + Intronic
1139482720 16:67239420-67239442 GCTCTGCAAGTGTCTCCCTCCGG - Exonic
1142132966 16:88439140-88439162 ACTGGGCAAGGCCTTCCCCCAGG + Exonic
1142206857 16:88787144-88787166 TCTCTGCAAGTCTCACCCTCTGG + Intergenic
1143391912 17:6564068-6564090 ACTCTCCGAGGTCCTCACTCTGG + Intergenic
1143726514 17:8850600-8850622 ACTCTGGGAGGACCTCCCACTGG - Intronic
1144766737 17:17737332-17737354 TCTGGGCAAGACCCTCCCTCGGG - Intronic
1145060135 17:19727995-19728017 ACCCTGCCAGACCCTGCCTCTGG - Intergenic
1152572285 17:81126109-81126131 ACTCTGCTAAGCCCTCGCTTTGG - Intronic
1153615389 18:6929363-6929385 ACTCTACAGGGCTCTCCCTCTGG - Intergenic
1153954050 18:10081105-10081127 ATTCAGCAAGGCCAGCCCTCAGG - Intergenic
1154482525 18:14847727-14847749 AGTCTGAAAGGCCTTGCCTCAGG - Intronic
1154502169 18:15002458-15002480 ACTCTGCCAGCCCCTCCCAAAGG + Intergenic
1157747718 18:50151014-50151036 ACTCTTCAAGGCCAGCTCTCAGG + Intronic
1158897055 18:61923934-61923956 CCTGTGCAAGCCACTCCCTCGGG + Intergenic
1163329450 19:16627538-16627560 TCTCTGCCTCGCCCTCCCTCCGG - Intronic
1164828451 19:31301623-31301645 ATTCCGCAAGGTCCACCCTCAGG + Intronic
1166120326 19:40682624-40682646 CCTCTGCACATCCCTCCCTCAGG - Intronic
1166225911 19:41395186-41395208 ACCTTCCCAGGCCCTCCCTCAGG - Intronic
1166568354 19:43778799-43778821 TCTCTGCCAGCCCCTCCCCCTGG + Intronic
1167636022 19:50656235-50656257 ACTCTGCAATGACCTGCCGCAGG - Exonic
925064837 2:921863-921885 ACTCTGCAAGCCCCTGGATCCGG - Intergenic
925952310 2:8926765-8926787 ACTCTGCCAGCCAGTCCCTCTGG - Intronic
927516627 2:23675342-23675364 CCTCTGCAATGCCCACCCTCTGG + Intronic
929841308 2:45466846-45466868 AGTCTCCTGGGCCCTCCCTCAGG - Intronic
930185717 2:48410551-48410573 TCTCTGGAAGGCCCTCTCACTGG - Intergenic
930315946 2:49797038-49797060 TTTCTCCAAAGCCCTCCCTCTGG + Intergenic
938501344 2:131832630-131832652 ACTCTGCCAGCCCCTCCCAAAGG + Intergenic
938526285 2:132135801-132135823 ACTCAGAAAGGCCTTGCCTCAGG + Intergenic
943658446 2:190533644-190533666 GCTGGGCATGGCCCTCCCTCCGG - Intronic
946668484 2:222076451-222076473 CCTCAGGAAGGTCCTCCCTCAGG + Intergenic
947969241 2:234308134-234308156 CATCAGCAAGGCCCTCACTCAGG - Intergenic
948587083 2:239026261-239026283 TCTCTGCAAGGCCACTCCTCAGG - Intergenic
948696361 2:239734991-239735013 AGTCTGCCAGGGCCTCCCCCAGG + Intergenic
948835441 2:240624025-240624047 GCTCTGCAGGGCCCTGGCTCTGG + Intronic
948953684 2:241271970-241271992 CCTCAGCACGGCCCTCCCACAGG + Intronic
1168963203 20:1882792-1882814 ACAGTGCAATGCCCTCCCTCAGG + Intergenic
1171384714 20:24762630-24762652 TCTCTGCATGGCCCTGCCTAGGG + Intergenic
1172872312 20:38143441-38143463 GGTATGCAGGGCCCTCCCTCCGG - Intronic
1175462151 20:59159762-59159784 GCTCAGCAATGCCCTGCCTCGGG - Intergenic
1175918558 20:62439091-62439113 CCTCTCCAAGGCGCTCCCTGTGG - Intergenic
1176138110 20:63533900-63533922 ACTCTGCAGGGTCCTGGCTCCGG - Intronic
1176798075 21:13388901-13388923 AGTCTGAAAGGCCTTGCCTCAGG + Intergenic
1178334679 21:31732309-31732331 GCTCTGCAAGGCCGTCTCCCCGG - Intergenic
1178484211 21:33006971-33006993 ACTCTGCAGGGCCATCGCCCGGG + Intergenic
1180092274 21:45539263-45539285 ACTCTGCCAGGCCTGGCCTCCGG - Intronic
1180435136 22:15294346-15294368 ACTCAGAAAGGCCTTGCCTCGGG - Intergenic
1180744552 22:18078546-18078568 ACTCTGCCAGGCCCGCTCGCAGG - Exonic
1180833433 22:18918238-18918260 AGTCTCCAAGCCTCTCCCTCAGG + Intronic
1181042131 22:20197167-20197189 CCTGTGGAAGTCCCTCCCTCAGG - Intergenic
1181066393 22:20308017-20308039 AGTCTCCAAGCCTCTCCCTCAGG - Intergenic
1181440717 22:22934010-22934032 ACCCTGCAGGGCCCTGCCTTGGG - Intergenic
1181623431 22:24106295-24106317 CCTCTGCAAGGTCATCTCTCAGG - Intronic
1183668186 22:39257017-39257039 CCCCTTCCAGGCCCTCCCTCTGG - Intergenic
1184716929 22:46287757-46287779 AGCCTGCCATGCCCTCCCTCAGG - Intronic
1185032325 22:48450595-48450617 CCAAAGCAAGGCCCTCCCTCGGG + Intergenic
1185032728 22:48453193-48453215 CCAAAGCAAGGCCCTCCCTCAGG + Intergenic
1185399736 22:50609631-50609653 ACTCTGCCTGCCTCTCCCTCTGG + Intronic
1203283518 22_KI270734v1_random:143536-143558 AGTCTCCAAGCCTCTCCCTCAGG + Intergenic
949537842 3:5009688-5009710 CCTCTGCACTGGCCTCCCTCAGG - Intergenic
950508539 3:13411582-13411604 ACACTGGAAGCCCCTGCCTCTGG + Intronic
952675970 3:36030592-36030614 ACTCTTCAAGTCCATCCTTCTGG + Intergenic
953588394 3:44226981-44227003 ACACTACAAGGCTTTCCCTCTGG - Intergenic
954453088 3:50582186-50582208 GCTCGCCAAGGCCCTTCCTCAGG - Exonic
955907937 3:63827267-63827289 AACATGCAAGGCCCTCCCTTGGG - Intronic
956717637 3:72092380-72092402 ACTCTGCAAGGCTCTCAGTTGGG + Intergenic
960695080 3:120388113-120388135 ACTCAGCAAGGCCCATCATCAGG - Intergenic
960818894 3:121705876-121705898 ACTCAGCAAGGTCTTGCCTCAGG + Intronic
961136168 3:124513377-124513399 ACTCTGGGAACCCCTCCCTCTGG - Intronic
961678547 3:128583442-128583464 ACTCTGCAGGGGCCTCTTTCAGG - Intergenic
962616132 3:137128473-137128495 AGTCTGCCAGGCCCATCCTCGGG + Intergenic
964753083 3:160070032-160070054 CCTGGGCAATGCCCTCCCTCTGG + Intergenic
965711855 3:171563576-171563598 ACACACCCAGGCCCTCCCTCTGG + Intergenic
966911236 3:184561601-184561623 TCTCCGCCAGGCCCACCCTCGGG - Intronic
966919309 3:184601882-184601904 GCTCCCCAACGCCCTCCCTCCGG + Intronic
967109971 3:186284474-186284496 GCTCTGCAAGGCCGGCCCTTTGG + Intronic
969843708 4:9902581-9902603 TGTCTGCAGGGCCCTGCCTCTGG + Intronic
975841636 4:78480485-78480507 TCAGTGCCAGGCCCTCCCTCTGG - Intronic
977682670 4:99813142-99813164 ACCCTGGAAGTCCCTGCCTCTGG + Intergenic
984556987 4:181226060-181226082 GTTTTCCAAGGCCCTCCCTCTGG - Intergenic
985570326 5:641237-641259 ACGCTGCAAGGGCCTCCCCACGG + Intronic
985668736 5:1195630-1195652 ACCCTGCAGGGTCCTCCCACAGG - Intergenic
985846762 5:2355396-2355418 CTTCTGCAAGTCCCTCCCTGGGG - Intergenic
986592541 5:9386443-9386465 ACACTGCAAGACCTTCCCTGTGG + Intronic
990741952 5:58921489-58921511 ACCCTCCCAGGCCCTCCCTGTGG + Intergenic
992907086 5:81357188-81357210 ACCCTGAAGGGCCCTTCCTCTGG + Intronic
994745003 5:103667143-103667165 ACTCTGCCAGCTCCTCCCTATGG + Intergenic
996975943 5:129434672-129434694 TCTTTCCAAGGCTCTCCCTCTGG - Intergenic
997668185 5:135649027-135649049 ACTCTGCAGGGCTCTCCCAGAGG - Intergenic
999083426 5:148865824-148865846 ACTCCTCAAGTCCCTCCCTGTGG - Intergenic
999467712 5:151823019-151823041 TCCCTGCAAGGCACTCCCTTGGG + Intronic
1002197482 5:177509261-177509283 GCTCTGCCAGACCCTGCCTCCGG - Intronic
1002826307 6:777353-777375 ATTCAGCAAGGACCTGCCTCTGG - Intergenic
1005931291 6:30486406-30486428 ACTTTGAAAAGCCCTTCCTCTGG + Intergenic
1005989425 6:30893722-30893744 ATTCTCCCAGGCCCTCCCTGAGG - Intronic
1008357984 6:50578036-50578058 CCTCTGGTAGGCCCTCCCTAGGG - Intergenic
1010522913 6:76863034-76863056 TCTCTGCAAGGCCATTTCTCTGG + Intergenic
1010884013 6:81215120-81215142 TCCCTGTAAGGCCCTCCTTCAGG + Intergenic
1011290436 6:85771609-85771631 ACAGTGCTAGCCCCTCCCTCTGG + Intergenic
1011758679 6:90533516-90533538 ACTCTGGACTGCCCTCCCTGTGG - Intronic
1011778344 6:90758371-90758393 ACTCTGCAATCCATTCCCTCAGG - Intergenic
1016664962 6:146628502-146628524 CCTCAGCAAGGCCCTCAGTCAGG + Intronic
1017110670 6:150929112-150929134 ACCCTGCAAGGAGCTGCCTCTGG + Intronic
1017125986 6:151065274-151065296 TCCCTGCTAGGCCTTCCCTCTGG - Intronic
1017764034 6:157592717-157592739 ACCCAGCCAGGCCCTCCCTGTGG - Intronic
1018930889 6:168239623-168239645 GCTCTTCAGGGCCCTGCCTCAGG - Intergenic
1021241050 7:18201532-18201554 CATCTGCAGGGCCCACCCTCAGG + Intronic
1021970443 7:25960622-25960644 TGTCTGCAGGGCCCTCCCTCTGG + Intergenic
1032082811 7:128868610-128868632 GCTCTGCGTGTCCCTCCCTCAGG + Intronic
1032413589 7:131719084-131719106 ACCCAGCAAGGCTCTCCTTCTGG - Intergenic
1033981159 7:147167395-147167417 ACTTTGAAAAGCCCTTCCTCTGG + Intronic
1036523320 8:9512517-9512539 ACTCTTCAAGGAACTCCCTAGGG - Intergenic
1040543219 8:48377892-48377914 ACTCTGCAGGCCCCTACCACTGG - Intergenic
1042171066 8:65991369-65991391 ACTTAGCAAGGACCTCCCTGTGG - Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1044263945 8:90160971-90160993 GCTCTGCAAAGCCCTCATTCTGG - Intergenic
1047672720 8:127165790-127165812 ACTGTGCCTGGCCCTCCCTTAGG + Intergenic
1049373546 8:142278806-142278828 CTTCTGCAGGCCCCTCCCTCTGG - Intronic
1052965725 9:34339222-34339244 ACCCTGCCAGGCCCTCCCCAAGG + Intronic
1053144631 9:35704174-35704196 ACTAAGCTGGGCCCTCCCTCAGG - Exonic
1053474575 9:38372715-38372737 ACTCTTCCAGGCCCTCCTTTGGG + Intergenic
1053704982 9:40743137-40743159 ACTCAGAAAGGCCTTGCCTCAGG + Intergenic
1054415059 9:64866744-64866766 ACTCAGAAAGGCCTTGCCTCAGG + Intergenic
1059329916 9:113528452-113528474 ACTCAACAGGGCCCTCCTTCAGG + Intronic
1061795278 9:133082526-133082548 CCTCTGGGTGGCCCTCCCTCTGG - Intronic
1061985037 9:134125764-134125786 ACACTGCAAGATTCTCCCTCAGG + Intergenic
1061988300 9:134143185-134143207 CCTGTGCAAGGCCCGCTCTCCGG - Intronic
1062049103 9:134438047-134438069 GCACTGGAAGGCCCTCCCTTTGG + Intronic
1062235658 9:135506467-135506489 GCTCTGCCAGGCCCATCCTCTGG - Intergenic
1062262488 9:135669943-135669965 ACTCTGAGAGTCCCTGCCTCAGG + Intergenic
1062451397 9:136617208-136617230 AGTGGGCAAGGCCCTCCCTCAGG - Intergenic
1062452125 9:136620225-136620247 CCTCTGCAAGGCCGTCACTCCGG - Intergenic
1062498311 9:136841890-136841912 ACTCTGCCAGCCCCTCCCCAAGG - Intronic
1186136810 X:6529928-6529950 ACAGTGGAAGGCCTTCCCTCTGG + Intergenic
1186871507 X:13778388-13778410 ACTCTGCTTGTCCCACCCTCTGG - Intronic
1188466186 X:30484074-30484096 ACTCTAAAAGGCCCACCTTCTGG - Intergenic
1188521486 X:31043039-31043061 GCCCTGCAAGGCTGTCCCTCGGG - Intergenic
1190308264 X:49099032-49099054 ACTGTGCCAGGCCCCTCCTCTGG - Intronic
1191815101 X:65235503-65235525 TCTCTGCCTGGGCCTCCCTCAGG + Intergenic
1195244561 X:102983759-102983781 AGTCTGTAAGGCCCTTCCCCAGG + Intergenic
1198454926 X:136807385-136807407 ACTTTGAAAAGCCCTTCCTCTGG - Intergenic