ID: 1138462001

View in Genome Browser
Species Human (GRCh38)
Location 16:57154663-57154685
Sequence ATGGGGAAACTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1055
Summary {0: 1, 1: 0, 2: 10, 3: 94, 4: 950}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138461998_1138462001 -10 Left 1138461998 16:57154650-57154672 CCTCGTTTTAGAGATGGGGAAAC 0: 1
1: 18
2: 283
3: 1929
4: 6139
Right 1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG 0: 1
1: 0
2: 10
3: 94
4: 950
1138461993_1138462001 6 Left 1138461993 16:57154634-57154656 CCAATACTATCATCACCCTCGTT 0: 1
1: 0
2: 2
3: 10
4: 79
Right 1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG 0: 1
1: 0
2: 10
3: 94
4: 950
1138461992_1138462001 27 Left 1138461992 16:57154613-57154635 CCTTAGAACAATGCTATGCAGCC 0: 1
1: 0
2: 0
3: 22
4: 180
Right 1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG 0: 1
1: 0
2: 10
3: 94
4: 950
1138461997_1138462001 -9 Left 1138461997 16:57154649-57154671 CCCTCGTTTTAGAGATGGGGAAA 0: 1
1: 2
2: 69
3: 401
4: 1717
Right 1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG 0: 1
1: 0
2: 10
3: 94
4: 950

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138462001 Original CRISPR ATGGGGAAACTGAAGGAGGA AGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900115752 1:1027131-1027153 GTGGGGGGACTGCAGGAGGAGGG - Intronic
900522170 1:3111069-3111091 ATGGGGAAGCTGGAGGTGGGAGG + Intronic
901274971 1:7984075-7984097 ATGCTGAAACTGAAGGAGCAAGG + Intronic
901286835 1:8087107-8087129 ATGGGGAAAAGGCAGGAGGGAGG - Intergenic
902141783 1:14362898-14362920 ATAGAGAAACTGAGGCAGGAAGG + Intergenic
902169267 1:14597917-14597939 ATGGGTAAACTGAGGCAGCAGGG + Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902215251 1:14930706-14930728 ACAAGGAAACTGCAGGAGGAAGG - Intronic
902249838 1:15147064-15147086 ATGGGGAAACTGAAACAGAGAGG - Intergenic
902410936 1:16211202-16211224 ATGGGGAAGATGAAGGAGTGAGG + Intronic
902655661 1:17866239-17866261 AAGGGGAAAATGATGGGGGAGGG - Intergenic
902675611 1:18006556-18006578 AGGGGGGAACAGAAGAAGGAAGG + Intergenic
902713351 1:18255697-18255719 ATGGGGAAACAGTAGGAAGGGGG - Intronic
903054997 1:20629722-20629744 TTTGGGAAGCTGAGGGAGGAAGG + Intergenic
903177507 1:21589834-21589856 ATGGGGAAACTGAGGTCTGAAGG + Intergenic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
903308462 1:22432138-22432160 TGAGGGAAACTGAAAGAGGAAGG + Intergenic
903365774 1:22804781-22804803 AAGAGGACACTGAAGGAGCAGGG - Intronic
904466242 1:30709344-30709366 ATGAGGAAACTGAAGCATGGAGG - Intergenic
904742171 1:32686599-32686621 ATCGGGAAACTTCAGGAAGAAGG + Intronic
904761489 1:32807843-32807865 ATGAAGAGACTGAAGGAGAATGG - Intronic
904787240 1:32992165-32992187 ATGGTGAAACTGAGGCAGGGGGG - Intergenic
904823787 1:33261777-33261799 TTGGGGAAACTGAAGTGGGAAGG + Intronic
905150697 1:35924772-35924794 ACGGGGAGACTGTAGAAGGAAGG + Exonic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905392966 1:37650063-37650085 ATAGGAAAACTGAAGGAGGCTGG + Intergenic
906476642 1:46173681-46173703 ATTAGGAACCTGAAGGGGGAGGG + Intronic
906524585 1:46486820-46486842 GTGGGGAGACTCCAGGAGGAAGG + Intergenic
906581877 1:46941530-46941552 GTGGGGAGAGTGAAGGAGGAGGG + Intergenic
906601839 1:47137367-47137389 GTGGGGAGAGTGAAGGGGGAGGG - Intergenic
906615062 1:47228368-47228390 TTGGGGAGAATGAAGGAGGAGGG + Intronic
906616285 1:47235026-47235048 ATGGGGAACCTGGAGGCTGAGGG + Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906858551 1:49333795-49333817 ATGGCCAAACTGAACAAGGAGGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907009622 1:50951480-50951502 ATGGGGAAACTGAGGCAGAGGGG + Intronic
907263694 1:53240916-53240938 ATGGTGTAACTGAAAGAGCATGG + Intergenic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907355381 1:53868385-53868407 ATGAGGAAACTGAGACAGGAAGG - Intronic
907577573 1:55541083-55541105 ATGAGGAAACTAGAGGGGGATGG - Intergenic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
907894366 1:58671414-58671436 ATGGGGCATCTGCAGGAAGAGGG + Intronic
908235176 1:62141280-62141302 ATGAGGAACCTGAAGCAGGGAGG - Intronic
908261913 1:62345666-62345688 ATGAGGAAACTGAAGGTCTAGGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908582839 1:65535470-65535492 GTGGGGACACTGAGGCAGGAGGG - Intronic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
910075867 1:83278070-83278092 ATGGGGTATCTGTAGCAGGATGG + Intergenic
911110989 1:94185111-94185133 CTGGGCAAACTGCAGGTGGAAGG + Intronic
911860708 1:102944481-102944503 CTGGGATAACTGAAAGAGGATGG + Intronic
912048757 1:105495443-105495465 CTGGGGACACTGAAGAAGCAAGG - Intergenic
912654798 1:111476725-111476747 CTGGGGAAACTTAAGCTGGAAGG + Intronic
912667395 1:111594519-111594541 AAGGGGAAAGGGAAGAAGGAAGG + Intronic
913123770 1:115766334-115766356 ATGTGGAAACTGAAGCAGAGAGG - Intronic
913556453 1:119971972-119971994 ATGAGGGAAATGAGGGAGGAAGG + Intronic
914744379 1:150490809-150490831 ATGAGGAAGCTGGAGGAGAAGGG + Intronic
914921872 1:151852799-151852821 ATGGGGAAACTGAGGGAATACGG + Intronic
914934518 1:151966765-151966787 ATGGTGGCACTGAAGGATGATGG - Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915835697 1:159173087-159173109 GTGGGGAGAGTGAAGGGGGAGGG + Intronic
916100335 1:161388807-161388829 GTGAGGAAACTGCAGGAGGCTGG - Intergenic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916223152 1:162464578-162464600 AAGGGGAACCTAAAGGAGGAGGG - Intergenic
916439656 1:164810745-164810767 AGAGGTAAACTGGAGGAGGAAGG - Intronic
916572165 1:166037499-166037521 ATGTGGATAGTGAAGGAAGAGGG + Intergenic
916578013 1:166084387-166084409 ATGAGGAAACTGAAGGTGAAAGG - Intronic
916790110 1:168117503-168117525 ATGGGGAGACTGATGCAGGGGGG - Intronic
916943920 1:169704866-169704888 ATGAAGAAACTGAAGTTGGAGGG - Intronic
916997611 1:170317381-170317403 ATGAGGAAACTGAAGGTAAATGG + Intergenic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917098435 1:171422921-171422943 CTTGGGAATCTAAAGGAGGAAGG + Intergenic
917520645 1:175745697-175745719 ATGTGCAAACTCATGGAGGAGGG + Intergenic
917716479 1:177743161-177743183 GTGAGGAAACTGAAGCAGAAAGG - Intergenic
918029517 1:180791013-180791035 AGGAGGAAACTAAAAGAGGAGGG + Intronic
918102156 1:181385795-181385817 ATGGAGAAACGGAGGGAGGGAGG - Intergenic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918319986 1:183355116-183355138 ATGTGGAAACTGAGGAAGAAAGG - Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919103806 1:193124480-193124502 AAGGGGAAAGTGTAGAAGGAAGG + Intronic
919111478 1:193225028-193225050 AGGGGGAAACTGTGGGAGGGGGG - Intronic
919199891 1:194342756-194342778 ATCGGGAGACAGAAGGGGGATGG - Intergenic
919469211 1:197957998-197958020 GTGGGGAAGCTGTGGGAGGAAGG + Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
920290954 1:204922945-204922967 ATGGGGCCACTGTGGGAGGATGG - Intronic
920505585 1:206513222-206513244 ATGGGGAAACTGAGGAATGAGGG - Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
920793664 1:209117213-209117235 GTTGGGAGACTGAAGCAGGAAGG + Intergenic
921225335 1:213014030-213014052 TTGGGGGAAATGAAAGAGGATGG + Intronic
921740438 1:218678543-218678565 ATGAGGAAATAAAAGGAGGAAGG - Intergenic
922799832 1:228360135-228360157 ATGGGCAGCCTGGAGGAGGAGGG + Intronic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1064603998 10:17019372-17019394 ATGGGGAAAAGGAAGGGGTAGGG - Intronic
1064682459 10:17824830-17824852 ATGGGGAAACAGAAAGGGTAGGG - Intronic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065208328 10:23378350-23378372 ATGAGGAAACTGAAGCATGCAGG + Intergenic
1066363730 10:34756112-34756134 ATGGGGAGATTGGAGGAGGGAGG - Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067373100 10:45703045-45703067 ATGGGGAGAGTGAAGAATGAGGG + Intergenic
1067386675 10:45823077-45823099 ATGGGGAGAGTGAAGAATGAGGG - Intergenic
1067447593 10:46361530-46361552 ATGGGGAGAGTGAAGAATGAGGG + Intergenic
1067589787 10:47499237-47499259 ATGGGGAGAGTGAAGAATGAGGG - Intergenic
1067636911 10:48007337-48007359 ATGGGGAGAGTGAAGAATGAGGG - Intergenic
1067876580 10:50012998-50013020 ATGGGGAGAGTGAAGAATGAGGG + Intergenic
1068762305 10:60725865-60725887 ATAGGGAAACTGAAACAGAATGG + Intronic
1069060975 10:63894190-63894212 ATGGGAGAAGGGAAGGAGGAAGG - Intergenic
1069178137 10:65320816-65320838 ATGTGAAAACTGAAGGGTGATGG - Intergenic
1069319584 10:67151928-67151950 AGGGGGAAACTGGAGAAGAAAGG - Intronic
1069540952 10:69293407-69293429 TTGGAGATACTGGAGGAGGAAGG + Intronic
1069724457 10:70568310-70568332 ATGGGGAAACTGAGGCAGAGAGG - Exonic
1069948794 10:72005510-72005532 AGGGAGAAACTGATGGAGGTGGG + Intronic
1070133458 10:73671357-73671379 ATGGGGAGAGTGAAGAATGAGGG - Intergenic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070481209 10:76884523-76884545 ATGGGGGAAGTGAAGGAAGCTGG + Intronic
1070914430 10:80144046-80144068 CTGGGGAAACTGAGGCAGGTAGG + Intronic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1071385026 10:85111219-85111241 TTGGGAAAACTGAAGGCCGAAGG + Intergenic
1071472240 10:85991851-85991873 ATGTGGAAAATGTGGGAGGAGGG + Intronic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1072164650 10:92801618-92801640 ATGGGGAGAATGGGGGAGGATGG + Intergenic
1072340177 10:94439652-94439674 AAAGGGACACTGAAGGAGAAAGG - Intronic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1072681269 10:97508681-97508703 GTGGGGAAATTAAAGGAAGAAGG - Intronic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073460867 10:103665194-103665216 ATGGGGAAACTGAGGTAAGGAGG + Intronic
1073577342 10:104638114-104638136 TTGGGGAAAATGATGGAGGCTGG + Intergenic
1074335506 10:112570307-112570329 AGGGGGAAAATGAAGGAAGCAGG - Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074440339 10:113472242-113472264 ATGGGGACATCTAAGGAGGAAGG + Intergenic
1074790801 10:116885878-116885900 ATGGAGAAACTGCAGCAGCATGG - Exonic
1075439727 10:122470279-122470301 ATGAGGAAACTGAGGCAGAAGGG - Intronic
1075629478 10:123992310-123992332 GTGGGGCAACTGAGGGAGGCCGG - Intergenic
1075668366 10:124246361-124246383 ATGAGGAAACTGAGGCATGAAGG - Intergenic
1075709048 10:124521045-124521067 AAGGGGACAGTGCAGGAGGAGGG - Intronic
1076293834 10:129368492-129368514 ATGAGGAAACTGAGGCAGGGAGG + Intergenic
1076652115 10:131997014-131997036 AGAGTGAAACTGAAGGAGGCTGG + Intergenic
1076735536 10:132457403-132457425 AAGGGGAAACTGAGGCAGGGTGG + Intergenic
1076812888 10:132898467-132898489 ATGGGGCAACCCAGGGAGGACGG - Intronic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078758969 11:14236383-14236405 ATGGGAAGAATGAAGGAGGCTGG + Intronic
1079470398 11:20772672-20772694 ATGAGGCAACTCAAGGATGAAGG + Intronic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1080872928 11:36252573-36252595 ATGGGGAAACTGAGGCTTGAGGG - Intergenic
1081580817 11:44350453-44350475 ATAGGGAAGCTGAAGGATGGGGG - Intergenic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1081670620 11:44940231-44940253 ATGGGGAGGCTGGAAGAGGAAGG - Intronic
1081811817 11:45918413-45918435 CTGGGGAAACTGAGGCAGTAAGG + Intronic
1081981872 11:47271879-47271901 ATGAGCAAACTGCAGGAGGTGGG - Intronic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1084323004 11:68384059-68384081 CTGGGGAAACTGAGGCAGGCAGG - Intronic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084559029 11:69892405-69892427 ATGGGAAAACTGAGGCATGAGGG - Intergenic
1084775827 11:71374408-71374430 ATAGGGAAGCTGCTGGAGGAAGG + Intergenic
1084874755 11:72123126-72123148 ATGGGGAAACTGAGGTTTGAAGG - Intronic
1085196522 11:74675497-74675519 ATGAGGAAACTGAGGCAGAAAGG + Intergenic
1085330926 11:75650221-75650243 ATGAGGACAATGAAGCAGGAAGG + Intronic
1085514989 11:77106683-77106705 ATGGGCAAACTCAGGGAGGGAGG - Intronic
1085539149 11:77250242-77250264 TTGGGACTACTGAAGGAGGAAGG - Intronic
1085779302 11:79393938-79393960 AGGGTGACACTGAAGGAGGGAGG + Intronic
1086095494 11:83046374-83046396 ATGAGGAAACTGAAGGCCAAAGG - Intronic
1086440113 11:86821137-86821159 CTGGGGAAAGTGAAGCATGAAGG - Intronic
1086518665 11:87645848-87645870 AAGGGGGAAGTGAAGGGGGAAGG - Intergenic
1086518765 11:87646102-87646124 AGGGGGAAAGGGAAGGGGGAAGG - Intergenic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1089309626 11:117549105-117549127 ATGGGGAAACACATGTAGGAAGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1089668359 11:120034510-120034532 ATGGGGAGAGAGAAGGAGGCAGG - Intergenic
1090796496 11:130140174-130140196 ATGGGTATAATGGAGGAGGAGGG - Intronic
1091137164 11:133202289-133202311 AGAGGGAAAATGATGGAGGATGG - Intronic
1091451787 12:576599-576621 TTTGGGAGACTGAAGCAGGAGGG - Intronic
1091458903 12:629256-629278 GTGGGAAAACTGAAGCCGGAAGG + Intronic
1091862998 12:3803644-3803666 ATGGGTGAGCTGAAGGAGTAAGG + Intronic
1091942781 12:4504079-4504101 ATGGGATAACTGAAGGTGGGAGG + Intronic
1092138731 12:6167959-6167981 ATGGGGAAACTGAATCATGGGGG + Intergenic
1092226908 12:6753462-6753484 AAGGGGAAACTGGAGGACGAGGG + Exonic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093396523 12:18690059-18690081 ATTGAGAAAGTGAAGGTGGAAGG - Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1095369533 12:41450504-41450526 CTGGGGAATCTGAAGAAGGAGGG + Intronic
1095394162 12:41743453-41743475 CTTGGGAAGCTGAAGCAGGAGGG - Intergenic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096403615 12:51326851-51326873 AAGGGGGAACTGAAAGGGGAAGG - Intergenic
1096720273 12:53516237-53516259 ATGGTTAAACTAAAGAAGGAGGG + Exonic
1096794889 12:54070439-54070461 ATTGGGAAACTGAGTGAGCATGG + Intergenic
1097302034 12:58029217-58029239 ATCAGGAAAATGAAGGAAGAGGG - Intergenic
1097625777 12:61998589-61998611 ATGGGGAAACTGAAGCTCCAAGG + Intronic
1098047181 12:66412005-66412027 TTGGGGTACCTGAAGGAGAAGGG + Intronic
1098478202 12:70930202-70930224 ATGGGGAAACGGTAGGAAGGAGG - Intergenic
1098487926 12:71043205-71043227 ATGGGGGCACTGAAGTGGGATGG - Intergenic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1098823585 12:75265032-75265054 ATGAGAAATCTGTAGGAGGATGG - Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099271738 12:80519525-80519547 ATGGGCACTTTGAAGGAGGAGGG + Intronic
1099278567 12:80611260-80611282 ATCAGGAGTCTGAAGGAGGATGG - Intronic
1099602315 12:84756749-84756771 ATGAGGAAACTGGATGATGATGG - Intergenic
1099684154 12:85864811-85864833 TTGGAGTAACTGAAGGAGGCAGG - Intergenic
1099997708 12:89796863-89796885 AAGGGCAAACTGAAGAAAGATGG - Intergenic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1101396858 12:104356205-104356227 GTGGGGAAACTATAGGAAGATGG + Intergenic
1102039826 12:109793794-109793816 ATGGGAAAATAAAAGGAGGAAGG + Intronic
1102422657 12:112816216-112816238 ATGGGGAAACTGAAGCCTGGAGG - Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1103166251 12:118773088-118773110 ATGGGGAGCGTGAAGGGGGATGG + Intergenic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1103879546 12:124155472-124155494 ATGGGGAAACTGTTGGGGGAAGG - Intronic
1104061552 12:125272683-125272705 ATGGGGGAGCTAAAGGCGGAGGG + Intronic
1105325009 13:19362815-19362837 GTGAGGAAACTGCAGAAGGAAGG - Intergenic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1105984359 13:25550645-25550667 AAGGAGAAACGGAAGGAGAATGG - Intronic
1106027048 13:25965247-25965269 ATGGGGAAAATGTAGAAAGATGG - Intronic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1107904519 13:45049965-45049987 AAGGGGTAACTGAGGGAGCAAGG - Intergenic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1109846620 13:68000665-68000687 ATGGTGAAAGTTAAGGGGGAAGG - Intergenic
1109961164 13:69633965-69633987 ATGGGGAAAGAGAAGGAAGTGGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111995497 13:95162209-95162231 ATGTGGAAACTAAAGGAAGAAGG - Intronic
1112029066 13:95440431-95440453 TTGGGGAGGCTGAAGCAGGAGGG + Intronic
1112433310 13:99372381-99372403 GGGGGGAAAATGAAGGATGATGG + Intronic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1113706376 13:112435806-112435828 ATGAGGAAACTGAGGCAGCAAGG + Intergenic
1114133835 14:19823998-19824020 ATAGGGAAGATGAAGGAGAAGGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115810506 14:37101929-37101951 ATGAGGAAACTGAAACATGAGGG - Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1115957156 14:38794158-38794180 GTGGGGGAACTGGAGGAGGCTGG - Intergenic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116928904 14:50670305-50670327 AGGCGGGAGCTGAAGGAGGAAGG + Intergenic
1117403402 14:55378618-55378640 ATAGGGGAACTGAGGGAGGGAGG - Intronic
1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG + Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119531884 14:75367544-75367566 TTGGGGAAATTGAATGAAGAAGG + Intergenic
1119736309 14:76984942-76984964 AGGAGGAAGCTGATGGAGGAGGG - Intergenic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119919451 14:78432796-78432818 ATGGGGAAACTGTGGCAGTAAGG + Intronic
1120061608 14:79989948-79989970 CTTGGGAAACTGAGGCAGGAGGG - Intergenic
1120611285 14:86645249-86645271 ATGGGAAAATTGATGGAGAAAGG - Intergenic
1120815618 14:88854788-88854810 CTTGGGAGACTGAAGCAGGATGG - Intronic
1120880482 14:89412109-89412131 ATGAGGCAGCTGAAGGAGTAGGG + Exonic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121573433 14:94964464-94964486 ATGGGGAAACTGGAGCTTGAGGG - Intergenic
1121631685 14:95425670-95425692 ATGGGGAAGATGGAGGAGGCTGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122409016 14:101516759-101516781 ATGGGGATGCTGGAGGAGGTGGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122873159 14:104650685-104650707 ATGGGGAGACTGAGGCAGGGTGG - Intergenic
1123123262 14:105927824-105927846 ATGGAGAGACTGGAGGAGGCAGG - Intronic
1123145362 14:106124614-106124636 ATAGGGAAACTGAAAGACAATGG - Intergenic
1123185580 14:106513500-106513522 GTAGGGAAACTGAAAGAGAATGG - Intergenic
1123576906 15:21679585-21679607 ATAGGGAAGATGAAGGAGAAGGG - Intergenic
1123613528 15:22122053-22122075 ATAGGGAAGATGAAGGAGAAGGG - Intergenic
1123736377 15:23188189-23188211 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1123971954 15:25515749-25515771 ACGGGGAAACTTCAGGAGCAGGG + Intergenic
1124287083 15:28411166-28411188 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124295618 15:28500463-28500485 AAGGGGAAAGCGAAGGAGAAAGG + Intergenic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1124658050 15:31524554-31524576 TTGGGGGAACGGAAGGAGGGAGG - Intronic
1124887504 15:33700963-33700985 ACGGGGAGGCTGAGGGAGGAGGG - Exonic
1125364609 15:38900571-38900593 ATGTGGAATCTGAGGGAGAAAGG + Intergenic
1125881834 15:43202055-43202077 ATGAGGAAACTTACTGAGGAGGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127418027 15:58776295-58776317 ATGGGGAGACTGAGGCAGGATGG - Intronic
1128016402 15:64351769-64351791 ATCGGGAGACTGAGGCAGGAGGG + Intronic
1128395978 15:67226238-67226260 TTGGGGAGGCTGAAGCAGGAAGG - Intronic
1128484258 15:68069340-68069362 ACGGGCAAAAGGAAGGAGGAGGG - Intronic
1128563413 15:68683249-68683271 GTGGGGAGCCTGAAGGACGAAGG + Intronic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1128866704 15:71119864-71119886 ATGGGGAAACTGAGGCTGGGTGG - Intronic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129025235 15:72565786-72565808 ATGGGGAATGGGAAGGAGCAGGG - Intronic
1129255429 15:74331453-74331475 ATGGGGCGCCTGAATGAGGAGGG - Intronic
1129553470 15:76479161-76479183 ATGAGGAAAAAAAAGGAGGAGGG + Intronic
1129698742 15:77755386-77755408 ATGAGGAAACTGAAGCATGGAGG + Intronic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130293879 15:82629178-82629200 ATGGGGAAACTGAGGGATAGAGG - Intronic
1130411368 15:83651338-83651360 ATGAGGAAACTGAAGTGGAAAGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130856023 15:87840841-87840863 ATAGAGAAAGTGAGGGAGGAAGG + Intergenic
1131305730 15:91241459-91241481 ATGAGGGAAATGAAGGATGATGG - Intronic
1131405677 15:92162528-92162550 ATGAGGAAACTAAGGCAGGAGGG + Intronic
1131514114 15:93066056-93066078 GTGGGGCAACTGAGGGAGGCCGG + Intronic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1132006845 15:98235082-98235104 ATGGGAAAACTGAACCAGGAAGG - Intergenic
1132023820 15:98387395-98387417 TTGGGGAAATTGTAGGGGGAGGG + Intergenic
1202985774 15_KI270727v1_random:413830-413852 ATAGGGAAGATGAAGGAGAAGGG - Intergenic
1132609382 16:807647-807669 GTGGGGAAACTGAGGTAAGACGG + Intronic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133184892 16:4088975-4088997 CTGGGGAAACTGAAGGGAAATGG - Intronic
1133222669 16:4325492-4325514 ATGGGGAAACTGAGGGCTGAAGG - Intronic
1133346966 16:5077671-5077693 TTGGGGAAGCTGGGGGAGGAGGG + Intronic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134404806 16:13947146-13947168 ATGGGGAAAGGGAAGGAGCTGGG - Intronic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134788955 16:16971160-16971182 ATCTAGAAACTGAAGGAAGATGG - Intergenic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135021139 16:18964138-18964160 ATGGGGAAACTAAAGGAAGGGGG - Intergenic
1135174301 16:20214584-20214606 GTGGGGAAACTGCAAGGGGATGG + Intergenic
1135346808 16:21695737-21695759 TTGGGGAAAATGAAGGAAGTGGG - Intronic
1135352521 16:21740992-21741014 ATGGGAAAACTGCTCGAGGAGGG - Intronic
1135451009 16:22557114-22557136 ATGGGAAAACTGCTCGAGGAGGG - Intergenic
1135495022 16:22943821-22943843 AGGGGGATACAGAAGGATGAGGG + Intergenic
1135614940 16:23903071-23903093 TTGGGGAGGCTGAAGCAGGAGGG - Intronic
1135627288 16:24007134-24007156 ATGAGGAAACTGAAGCAGGGAGG - Intronic
1135660405 16:24291720-24291742 ATGAGGAAACTGAGGCAGGAGGG - Intronic
1135792439 16:25409552-25409574 ATGAGGAACCTGAAGCAGGGGGG + Intergenic
1136054565 16:27678787-27678809 AAGGTGAACCTGAAGGAGGGAGG + Intronic
1136693743 16:32057169-32057191 ATAGGGAAACTGAAAGACAATGG + Intergenic
1136794231 16:33000404-33000426 ATAGGGAAACTGAAAGACAATGG + Intergenic
1136875676 16:33853975-33853997 ATAGGGAAACTGAAAGACAATGG - Intergenic
1137670381 16:50274978-50275000 ATGGGGAAACTGAGGCAGGTGGG + Intronic
1137887903 16:52126375-52126397 ATGGGGTAAATGAGGGGGGATGG + Intergenic
1137992714 16:53175983-53176005 ATGGGGATATTGAAGCTGGAAGG + Intronic
1138074177 16:54024656-54024678 ATGGGAAAACCGAGGGAGAATGG - Intronic
1138222946 16:55268580-55268602 AGGGTGATCCTGAAGGAGGAAGG - Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138976899 16:62218639-62218661 AAGTGGAAAATGAGGGAGGAAGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139433632 16:66924303-66924325 ATGGGGAAAGGAAAGGAGAAGGG - Intronic
1139461100 16:67123178-67123200 GTGGCAAAACTAAAGGAGGAAGG - Intronic
1140782318 16:78307982-78308004 ATGTGGCAGCTGATGGAGGAAGG + Intronic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141617267 16:85217102-85217124 ATGGGGAAACGGAAGCAGAAAGG - Intergenic
1141624790 16:85255360-85255382 ATGGGGAAACTGAGGCTGGGAGG - Intergenic
1141678848 16:85532196-85532218 ATGGGGAAACTGAGGCACGTAGG + Intergenic
1141894337 16:86948936-86948958 ATGGGGAAACTGAGGCATGAGGG + Intergenic
1142043426 16:87909950-87909972 ATGGGGAAACTGAGGCTAGAAGG - Intronic
1203096495 16_KI270728v1_random:1262085-1262107 ATAGGGAAACTGAAAGACAATGG + Intergenic
1142641925 17:1289353-1289375 ATGGGGAACCTGGTGGGGGATGG - Intronic
1142742693 17:1940424-1940446 GAGGGGAAACTGAGGTAGGAGGG - Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143492082 17:7290418-7290440 GTGGGGCAACTGAGGGAGGCCGG + Exonic
1143579998 17:7819885-7819907 ATGAGGACCCTGAAGGAAGAGGG - Intronic
1143616269 17:8051873-8051895 ATGGGGCAATAGAAGGATGAAGG - Intergenic
1143703101 17:8676080-8676102 TTGGGGGAACTGAGGAAGGAGGG - Intergenic
1143855327 17:9843996-9844018 ATGGGGAAACTGATGCAGACAGG + Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144327711 17:14197563-14197585 ATGGGGTAAGTGAGGTAGGATGG + Intronic
1144346328 17:14353267-14353289 ATGGGGAAGTTGAAGGACAAGGG + Intergenic
1144402636 17:14920985-14921007 ATTGGTAAATTGAAGGAAGATGG + Intergenic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144529042 17:16018402-16018424 ATGAGAAAACTGATGGAAGAGGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1146429267 17:32775056-32775078 TTTGGGAGACTGAAGCAGGAGGG + Intronic
1146596476 17:34173404-34173426 GTGGGGAAATGCAAGGAGGAGGG + Intronic
1147156205 17:38545562-38545584 ATGGGAAAACTGAGGCAGGGAGG + Intronic
1147471520 17:40666484-40666506 ATGGGGAAGGTGCAGGAGGTAGG - Intergenic
1147671589 17:42179997-42180019 ATGGGGACACTGAAGGTGCCTGG + Intronic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1147908714 17:43841576-43841598 ACAGGGAAAATGATGGAGGAGGG - Intergenic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148164308 17:45472348-45472370 ATGGGGAAACTGGAGGGTCAAGG - Intronic
1148247127 17:46039954-46039976 CTGGGCAAATTAAAGGAGGATGG - Intronic
1148330385 17:46810581-46810603 ATGAGAAAACTGAGGGAGGGAGG + Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148774799 17:50089285-50089307 AAGGGGACACTGGGGGAGGAGGG - Exonic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1149434776 17:56624039-56624061 GTAGGGAAAGTGTAGGAGGAGGG + Intergenic
1150264410 17:63822907-63822929 ATGAGGAAACTGAGGCAGCAAGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150395537 17:64819001-64819023 ATGGAGAAACTGGAGGGGCAAGG - Intergenic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151062196 17:71108472-71108494 ACTGGGAAACTGAAGTGGGAGGG - Intergenic
1151171937 17:72253971-72253993 TGGGGGAATCTGAAGGAGGGAGG + Intergenic
1151215568 17:72574570-72574592 ATGGACAACCTGCAGGAGGAAGG - Intergenic
1151920093 17:77148168-77148190 AAAGGGAAAATGAAGGAGGCGGG + Intronic
1152089242 17:78237822-78237844 ATGGGGAGGCTGAGGGAGGGAGG - Intronic
1152096209 17:78273145-78273167 ATGGGGGAACAGCAGGAGGTAGG + Intergenic
1152184564 17:78846336-78846358 GTGGGGAAACTGAAGGGAGCCGG - Intergenic
1152262427 17:79274298-79274320 ATGAGGAAACTGAGGCAGCAAGG - Intronic
1152302025 17:79500621-79500643 ATGGGGAAATTGAAGGGGGAAGG - Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152370349 17:79884072-79884094 ATGGCGAAAGGCAAGGAGGAAGG - Intergenic
1152412793 17:80137690-80137712 ATGGAGAAAATGAAGTAAGAGGG - Intronic
1152609237 17:81307485-81307507 AAAGGGAAAGTGAAGGGGGAGGG - Intergenic
1152659333 17:81535224-81535246 ATGGGGATGATGGAGGAGGAAGG - Intronic
1153045057 18:848354-848376 AAGTGGGAAGTGAAGGAGGAAGG - Intergenic
1154156095 18:11945376-11945398 ATGTGGACACTGAAAGAGTAAGG - Intergenic
1154388619 18:13917607-13917629 ATGGGGAAACAGAAGGGGACAGG + Intergenic
1155523800 18:26696239-26696261 ATTGGGAAGCTGAGGGAAGATGG + Intergenic
1155625146 18:27826005-27826027 AGGTGGAAACTGAAGGTTGAAGG + Intergenic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1155822119 18:30391101-30391123 ATGGGGAACTAGAAGGCGGATGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155986740 18:32238220-32238242 AAGGGGAAGCTGAAGAATGATGG + Intronic
1156354843 18:36332061-36332083 AAGGGAACACTGCAGGAGGAAGG - Intronic
1156764565 18:40636263-40636285 GTGAGGAAACTGTAAGAGGAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157584794 18:48794133-48794155 ATGGGGAAAGTGAGGTAGAATGG - Intronic
1157762696 18:50275898-50275920 ATGGGGCAGCTGCAGGAGGCAGG + Exonic
1157842661 18:50973764-50973786 AAGGGGAAACTGAGGGGTGAGGG - Intronic
1158185402 18:54765709-54765731 ATGGGGAAAGGAAAGGAAGAAGG - Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158796590 18:60853719-60853741 ATGAGGAAACTGAAGAAGAGAGG - Intergenic
1158900311 18:61956266-61956288 ATGGGGCAATGGAAGGAGGTAGG - Intergenic
1159018607 18:63123942-63123964 ATGGGAACACTGGTGGAGGATGG - Exonic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159555002 18:69936377-69936399 AATGGGAAACTGAAAGTGGATGG - Intronic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1160479593 18:79226632-79226654 ATGGGGCAAAGGAAGGGGGAAGG - Intronic
1160694821 19:478373-478395 ATGGGGAAACGGAGGCAGGTGGG - Intergenic
1160729650 19:635325-635347 ATGGGGAAACTGAAGTGCCAGGG - Intergenic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161313786 19:3608644-3608666 ATGGGGAAACTGAGGCACAAAGG + Intergenic
1161519660 19:4716731-4716753 GTGGGGAAACTGAAGCTGGGAGG + Intronic
1161626535 19:5330297-5330319 ATGGGGAAACTGAGGCACAAAGG - Intronic
1161841020 19:6680341-6680363 GTGGAGAAACTGAAGGATCAAGG + Intronic
1161898747 19:7101886-7101908 ATGAGGAAACTGAAACACGAAGG + Intergenic
1161970658 19:7578044-7578066 AAGAGGACACCGAAGGAGGAAGG + Intergenic
1162024862 19:7888252-7888274 CTGGGGAAACTGAGGGAGCTGGG - Intergenic
1162153565 19:8661955-8661977 TTTGGGAAACTGAGGAAGGAGGG + Intergenic
1162234431 19:9296175-9296197 ATATGGATACTTAAGGAGGAGGG + Exonic
1162312483 19:9915060-9915082 ATGGGGAAACTGAGGCAGAGAGG - Intronic
1162509735 19:11110834-11110856 ATGGGGAAACTGAGGCATGAGGG - Intronic
1162844725 19:13383366-13383388 ATGGGGAAGATGGAGGAAGAAGG + Intronic
1162876782 19:13626590-13626612 AAGGGGAAAGGGAAGGGGGAAGG + Intergenic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163879053 19:19901636-19901658 ATGGGGAAAAAGAAGGGGTAGGG - Intronic
1164675581 19:30098227-30098249 ATGGGTAATCTGAAGGATCAAGG - Intergenic
1165396044 19:35563988-35564010 ATGGGGAAACTGAGGCATGGAGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165717626 19:38056512-38056534 AGGGGTAAACTGACGAAGGATGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166562230 19:43740550-43740572 ATGAGGAAACTGATGGAAAAAGG - Intronic
1166679689 19:44759028-44759050 CTGGGGGGTCTGAAGGAGGAGGG - Intronic
1167278506 19:48552944-48552966 ATGGGGAAACTGAGGCTGGGAGG + Intronic
1167418440 19:49389417-49389439 ACGGGGACACTGAAGCAGGATGG - Intronic
1167557351 19:50204535-50204557 ATGTGGAAACTGAGGCAGGAAGG - Intronic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1168074968 19:53975998-53976020 GTGGGGAAACTGAAGCAAGCTGG + Intronic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168426820 19:56245706-56245728 TTGAGGAAACTGAATGGGGAAGG - Intronic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
1168485129 19:56755006-56755028 AAGGGGAAAATGAAGGAGAAAGG + Intergenic
925130731 2:1492487-1492509 ATGGACAAAGTGAAAGAGGAAGG - Intronic
925372931 2:3360909-3360931 ATGGGGAAAGGGGAGGGGGAAGG + Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
926024110 2:9524783-9524805 TTGGGAAAACTGGAGAAGGAAGG + Intronic
926111192 2:10184820-10184842 ATGGGGAAACTGAGTCAGAAAGG + Intronic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926726803 2:16004910-16004932 ATGGGGAAACCGAGGCTGGAAGG + Intergenic
926893104 2:17655227-17655249 ATGATGAAAATGAATGAGGATGG + Exonic
927085320 2:19669432-19669454 ATGGCAACACTGAAGGATGATGG + Intergenic
927192647 2:20527395-20527417 ATGGGGAAACTGAGGCAGTAGGG + Intergenic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927739658 2:25557080-25557102 ATGGCAGAACTGAAGTAGGAAGG + Intronic
928026785 2:27746614-27746636 ATGGGGTAAGGGAAGGAGCATGG + Intergenic
928063194 2:28135883-28135905 ATGGATAAACTGAAATAGGAAGG - Intronic
928855408 2:35797027-35797049 AAGGGGAAACTAAAAGAGGAGGG + Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
929862972 2:45694968-45694990 ATAGCCAAACTGAAGGAGAAGGG - Intronic
930032067 2:47064456-47064478 ATGGGGAAACGTGAGAAGGAAGG + Intronic
930084063 2:47480221-47480243 AAGGGGGAAGGGAAGGAGGAAGG - Intronic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930845653 2:55900712-55900734 ATGGGGAAACTGGATGTGGCTGG + Intronic
931152814 2:59593969-59593991 GTGGGGAAATGGAAGGTGGAGGG + Intergenic
932319468 2:70810795-70810817 CTGGGGAAAGTGAAGCATGAAGG - Intronic
932722528 2:74148128-74148150 CTGGGGAGACTGAAGGAGAGCGG - Intergenic
932840525 2:75077849-75077871 ATTGGGAAATTGGAGGAGAAAGG - Intronic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933226421 2:79754482-79754504 ATAGGGCAAATGAAGGAGGAGGG - Intronic
933450441 2:82442712-82442734 ATTGGAAAAGTGGAGGAGGAGGG + Intergenic
933577677 2:84088179-84088201 ATGGGGAAACTAAAGCATGGAGG + Intergenic
933633347 2:84680907-84680929 ATGGGGAAGCTGAAGTGTGAGGG + Intronic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936780882 2:116030757-116030779 AGGGGGAAAAGGAAGGAGGGAGG - Intergenic
937259050 2:120573809-120573831 ATGGGGAAACTGAGGCATGTTGG + Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937406495 2:121634125-121634147 ATGGGAAAACTGAAGAGGGATGG - Intronic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938117615 2:128612622-128612644 ATGGTGGAAGTGAAGGCGGAGGG - Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938945620 2:136209395-136209417 ATGAGGAAGCTGAAGGATTAGGG + Intergenic
938973752 2:136456305-136456327 AAGGGGAAGGTGAAGGAGAAGGG - Intergenic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939057860 2:137384783-137384805 ATGGGGAAACTGCTCTAGGAGGG + Intronic
939218184 2:139267113-139267135 ATGGGGAAACTCCAGGAGGATGG + Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939675981 2:145072320-145072342 ATGAGGAAACTGCTGGAGGCTGG - Intergenic
939822649 2:146976658-146976680 AGGGGGACACTGGAGGAGAAAGG - Intergenic
939872378 2:147539902-147539924 ATGGGGAAACTGAAGCTTCAAGG - Intergenic
940158485 2:150684631-150684653 TTGGGGAAGCTGAGGGAGAATGG - Intergenic
940368343 2:152873735-152873757 ATTGGGAAGCTGAAGCAGGAGGG + Intergenic
941336739 2:164254975-164254997 CTGGGCAAACTCAAGGAGGTAGG + Intergenic
941407257 2:165105754-165105776 TTTGGGAGACTGAAGCAGGAGGG + Intronic
941990567 2:171552421-171552443 ATGGGGAGACAGAAGAAGGGAGG - Intronic
941998148 2:171621057-171621079 ATGGGGAATTTGAAAGGGGATGG + Intergenic
942871222 2:180736795-180736817 GTAGGGACACTGAAGGAGGAAGG + Intergenic
943689158 2:190851272-190851294 GTAGGTAAACTGAAGGAGGCTGG - Intergenic
944247877 2:197550627-197550649 CTGGGGAAAGTGAAGCATGAAGG + Exonic
944522600 2:200586953-200586975 AGGAGGAAACTGAGGCAGGAAGG + Intronic
945015397 2:205509610-205509632 GTAGGGATAGTGAAGGAGGAGGG + Intronic
945194910 2:207228672-207228694 ATGGAGTAACTGAAGTAGGGAGG - Intergenic
945564175 2:211375990-211376012 ATGAGGGAAAGGAAGGAGGATGG + Exonic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946098152 2:217293248-217293270 ATGAGGAGACTGAAGCAGAAAGG - Intronic
946208572 2:218129065-218129087 ATGGGGAAACTGAAGCCCAAAGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946380684 2:219346693-219346715 AAGGGGTGACTGGAGGAGGAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947085906 2:226452600-226452622 AGAAAGAAACTGAAGGAGGAGGG + Intergenic
947211445 2:227712159-227712181 TTTGGGAAGCTGAAGCAGGAGGG + Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
948148241 2:235724431-235724453 ATCGGGAAAATGAATGAGGGAGG - Intronic
948644848 2:239398053-239398075 ATGGGGGAACTGAAGGGCGAAGG - Intronic
948735062 2:239998229-239998251 AGGAGGAAAGTGAAGGAGGGAGG - Intronic
948906732 2:240983213-240983235 ATGGGGAAACTGAGCCTGGAGGG + Intronic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169387877 20:5166501-5166523 ATGGGGAAACTCAGGGAGAGTGG + Intronic
1169506889 20:6220770-6220792 TTGGGGCAACTCCAGGAGGAAGG + Intergenic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1170411184 20:16093875-16093897 ATGGGGACACTGAAGTCTGAAGG - Intergenic
1170910292 20:20559711-20559733 ATGAGGAAATAGGAGGAGGAGGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171156449 20:22878910-22878932 ATGGGGATAATGAGGGATGAAGG - Intergenic
1171209885 20:23309194-23309216 ATGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171956056 20:31464680-31464702 ATGGGGAAATTTTGGGAGGAAGG - Intergenic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1172483569 20:35285623-35285645 ATGGGGAAACCCCTGGAGGAGGG - Intergenic
1173418045 20:42876049-42876071 AGGGAGAGAGTGAAGGAGGATGG - Intronic
1173443604 20:43098342-43098364 ATGAGGAAACTGAGGCAGAAGGG - Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173564125 20:44027322-44027344 ACGGGGAAACATAAGAAGGAGGG - Intronic
1173572881 20:44088884-44088906 ATGGGGAAACTGAAGGACAGGGG - Intergenic
1173823866 20:46035160-46035182 ATGGGGAGGCTCAAGGAAGAAGG - Intronic
1174209818 20:48868671-48868693 AGTGGGAAACTGTAGTAGGAGGG - Intergenic
1174211999 20:48887200-48887222 ATGGGGAAACTGAGGCACGGAGG - Intergenic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175220676 20:57414761-57414783 GTGGGGAGACTGAAGCAGGAGGG - Intergenic
1175661974 20:60821243-60821265 ATGGGGAAGCTGAGGGATGCGGG + Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175912851 20:62412994-62413016 ATGGGGAAACTGAGGCACGGAGG + Intronic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176546533 21:8204703-8204725 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176554427 21:8248894-8248916 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176565484 21:8387750-8387772 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176573349 21:8431918-8431940 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176695205 21:9968864-9968886 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1177648689 21:23933469-23933491 ATGAGGAAAGGAAAGGAGGATGG - Intergenic
1177894854 21:26845849-26845871 AAGAGGGAACTGAGGGAGGAGGG - Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1179039991 21:37794357-37794379 ATGAGGAAACTGAGGCATGAGGG - Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179311080 21:40196649-40196671 GAGGGGAAAGTGAAGAAGGAAGG - Intronic
1179312026 21:40205023-40205045 AGGGGGAAATGGAAGGAGCAAGG + Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181336817 22:22141435-22141457 ATGGGGAAACAGAACTAGGCAGG - Intergenic
1181403099 22:22663657-22663679 ATGGGGAAAATCAAGAAAGAAGG + Intergenic
1181460437 22:23083043-23083065 GTTGGGAGAGTGAAGGAGGAGGG + Intronic
1181773982 22:25146635-25146657 ATGGGGAAACTGAAGTTCAAAGG - Intronic
1181869409 22:25886089-25886111 ATGGGGAAACTGAGGCACCAAGG - Intronic
1181917374 22:26292067-26292089 AGGAAGAAAATGAAGGAGGAAGG + Intronic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182307117 22:29377880-29377902 ATGAGGAAACTGAAGTACCAGGG + Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1182578176 22:31287838-31287860 ATGAGGAAACTGAGGCAAGAGGG - Intronic
1182711857 22:32328170-32328192 ATGGGGGAACTGAGGGCAGAAGG - Intergenic
1182865465 22:33600580-33600602 ATGGGGGAAAGGAAGGAGGTTGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183257395 22:36771254-36771276 AGGGGGAAACTGAGGCAGCACGG - Intronic
1183752249 22:39728184-39728206 ATGGGGAAACTGAGGTTTGAAGG - Intergenic
1183786441 22:40031594-40031616 ATGGAGAAACTGAGGCAGAAAGG - Exonic
1184344855 22:43907133-43907155 GTGGGGAAACTGAAGCAGCAAGG + Intergenic
1184381740 22:44149084-44149106 ATGGGGAAACTGAGGCTGGGGGG - Intronic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1184492579 22:44818585-44818607 ATGGGGAAACTGAGGCAGAGAGG - Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1203251396 22_KI270733v1_random:120965-120987 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203259442 22_KI270733v1_random:166039-166061 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
949130330 3:492394-492416 AGGGGCAAACTGAAGGAAAATGG + Intergenic
949431868 3:3985442-3985464 ATCGATAAACTGAAGGAGCATGG - Intronic
949830691 3:8211066-8211088 ATGTGGAAACTGAAGCACAAAGG - Intergenic
949931638 3:9083142-9083164 ATGGGGAAACATCAGGGGGAGGG - Intronic
949959035 3:9296684-9296706 ATGGGGAAACTGAGGCAGGGTGG - Intronic
950117183 3:10458905-10458927 AAGAGGAAACTGAGGCAGGAAGG - Intronic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
950716515 3:14851319-14851341 ATGAGGAAACTGAGGCAGGCAGG + Intronic
950947291 3:16962059-16962081 ATGGGGAAGCTCAGGGAGCATGG + Intronic
951132514 3:19064628-19064650 ATGGTGAAACTGAAGCATGCAGG + Intergenic
951559048 3:23947362-23947384 ATGGAAGAACTGAAGGGGGAAGG - Intronic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
953190174 3:40678585-40678607 ATTGGGAAAAGGAAGCAGGATGG - Intergenic
953228970 3:41046404-41046426 CTGGGGAAACTGGAGGAAGGGGG - Intergenic
953467107 3:43131717-43131739 ATGAGGAAACTGAGGCCGGAAGG + Intergenic
953482685 3:43265097-43265119 ATGGGGAATCGGGAGGAGCAAGG - Intergenic
953869656 3:46615391-46615413 GTGTGGAAAATGAAGGAGAAGGG - Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954023632 3:47764276-47764298 CTTGGGAGACTGAAGTAGGAGGG - Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
955379060 3:58422230-58422252 AGGTGGAAACTGGAGGAGGCAGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955892732 3:63667107-63667129 ATGAGGAAACTGAAGCACAAAGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
955942075 3:64156117-64156139 ATGTGGAAACTGAGGCATGAAGG + Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956313954 3:67913816-67913838 AGGGGAAAAGGGAAGGAGGAGGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956504046 3:69918653-69918675 ATGAGGAAACTGAGGGCAGAGGG - Intronic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956689282 3:71861105-71861127 ATGGGGAGCCTGAAGGGGGATGG - Intergenic
956778617 3:72587160-72587182 ATGGGGGAGCTGAAGGGAGATGG - Intergenic
957200863 3:77134485-77134507 AAGGAGAAACTGAAGGATAAAGG + Intronic
957526366 3:81383601-81383623 ATGCAGTTACTGAAGGAGGAGGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958259768 3:91367058-91367080 ATAGGGAAACTGAAGCAGGAGGG + Intergenic
959168020 3:102805145-102805167 ATGAGGAAACTGAGGGAGAAAGG + Intergenic
959557593 3:107739842-107739864 ATGAGGAAACTGAGGCAGAAAGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960176365 3:114522391-114522413 ATGGGGAAATTGAATATGGAGGG + Intronic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960639875 3:119814613-119814635 AGGGGGAAACTGAGGCAGAAAGG + Intronic
961144642 3:124584072-124584094 ATGGGGAAACTGAAGATAAAAGG + Intronic
961255335 3:125545791-125545813 ATGTGGAAACTAAGGGAGTAAGG + Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961591481 3:127984910-127984932 AAGGGGATTCTGAAGGAGAATGG - Exonic
961742371 3:129040774-129040796 CTGGGGAAACTGCAGGAGTCAGG + Intergenic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
963364203 3:144313760-144313782 ATGGGGAAACTGAGGCAAAAAGG - Intergenic
963755876 3:149234764-149234786 ACTTGGAAACTGAAAGAGGAAGG + Intergenic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
966706937 3:182926374-182926396 AGAGGGAAAATGAAGCAGGATGG - Intergenic
966931229 3:184677112-184677134 AAGGGGAAGTTGCAGGAGGAAGG + Intronic
966974797 3:185074302-185074324 ATGGGCATGCTGGAGGAGGATGG - Intergenic
967069215 3:185947343-185947365 ATGGGGAAACTTGAGGAAGAAGG + Intergenic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967600257 3:191378474-191378496 ATGGCAAAAGTGAAGGAGGTAGG + Intronic
967900196 3:194442038-194442060 ATGAGAAAACTGAAGCAGGGTGG + Intronic
967991081 3:195131236-195131258 ATGGGGAGACGGAAAGAGGGTGG - Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969463916 4:7343651-7343673 ATGGGGAAACTGAGGCAGGCAGG - Intronic
969502825 4:7563990-7564012 ATGTGGAAAGCAAAGGAGGAAGG - Intronic
969602096 4:8182620-8182642 ATGGGGAAACTGAGGCACGGAGG - Intronic
969639255 4:8387270-8387292 ATGAGGAAACCGAGGCAGGAAGG + Intronic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970696949 4:18689383-18689405 ACGGAGAAATTGAAGGAAGAGGG - Intergenic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
970837044 4:20421817-20421839 ATGGAGAAAGGGAAGGAGGGAGG - Intronic
970891170 4:21046223-21046245 ATGAGGAAACTCATAGAGGATGG + Intronic
971151181 4:24033201-24033223 AAGAGGAAACTGAAGCAGGGAGG - Intergenic
971267102 4:25105499-25105521 AGGGGGAGGCTGAAGGAGGCAGG - Intergenic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
971871563 4:32246577-32246599 ATGGGGAAAATGAAACAAGACGG - Intergenic
971968619 4:33593881-33593903 ATAGGGAAACTGAAGAAATAGGG + Intergenic
971987635 4:33846773-33846795 ATGAGGAAATTCAAAGAGGAGGG + Intergenic
972320072 4:37965228-37965250 ATGGGGAAACTGAAGCACTCAGG - Intronic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
972827321 4:42774732-42774754 GTGGGGAAAGTGTAGGAGGTGGG + Intergenic
974465918 4:62255796-62255818 ATGGGGAAAATGAAGAAAAATGG + Intergenic
975813132 4:78190419-78190441 ATGGGGGAAATGAAGAAGGGAGG - Intronic
975902093 4:79165213-79165235 ATGGGGATAATGATGGAGAATGG + Intergenic
976104159 4:81599102-81599124 AAAGGGAAACTGAAGGAGCCAGG - Intronic
976108118 4:81641225-81641247 ATGGGGATTCTGGAGGTGGATGG - Intronic
977459644 4:97309086-97309108 ATGGGGAAAATGAAACTGGAGGG + Intronic
977677261 4:99761877-99761899 GTGGGCAAATTGAAGAAGGAAGG - Intergenic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
978381697 4:108135522-108135544 ATGGCGAGAGTGAAGGTGGAGGG + Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
980367836 4:131829092-131829114 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
980429571 4:132676071-132676093 AAGGGGAAAATGAGGGAAGATGG + Intergenic
980585584 4:134810605-134810627 TTGGGGAGCCTGAAGCAGGAGGG - Intergenic
980824964 4:138062146-138062168 ATGGGGAAGTTTAAGGATGAGGG - Intergenic
981546557 4:145899859-145899881 ATGTTCAAACTGAAAGAGGAGGG - Intronic
981616885 4:146651806-146651828 AGGGGAAAATGGAAGGAGGAAGG - Intergenic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982162039 4:152579947-152579969 ATGGGGAAAATGTAGAAGAACGG + Intergenic
982179115 4:152733518-152733540 AGGGGGAAACTGATGAAGAAAGG + Intronic
982660852 4:158205036-158205058 TTTGGGAGGCTGAAGGAGGAAGG + Intronic
983098720 4:163597981-163598003 TTGGTGTATCTGAAGGAGGAGGG - Intronic
983274275 4:165598701-165598723 ATGGGGAAATTGAGGAAGGAAGG - Intergenic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984001344 4:174250164-174250186 ATGGGGAAACTGAAGCACAGAGG + Intronic
984236539 4:177165544-177165566 CTGGGGAAGCTGCAGGAGTATGG + Intergenic
984455163 4:179957370-179957392 ATGAGGAACCTGAGGGAAGAGGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987525514 5:19044941-19044963 ATGGGTAAACTGGGAGAGGAGGG + Intergenic
988351053 5:30107462-30107484 CTTGGGAGACTGAAGTAGGATGG + Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988495681 5:31743682-31743704 ATGGATGAACTGAAGGATGAAGG - Intronic
989110924 5:37905974-37905996 AGTGGGAAAATGAAGTAGGAAGG - Intergenic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989487178 5:42004919-42004941 ATGTGGAAACTGAGGGACGGAGG + Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990277112 5:54209153-54209175 ATGGGCAGAATGAAGGAGTAGGG + Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990629848 5:57656306-57656328 ATGAGGAAGCTGAAGAAGAAAGG + Intergenic
991515408 5:67429537-67429559 ATTGGGAAACTGAAGTGGGGAGG - Intergenic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992884974 5:81149648-81149670 ATGGTGAAACTCATGGAGGGTGG - Intronic
992896909 5:81253531-81253553 AGGGTGGACCTGAAGGAGGAGGG - Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992953252 5:81881572-81881594 ATGGAGAAAATGAAGCAGGGAGG + Intergenic
993045212 5:82858632-82858654 AGGGAGACACTGAAGGAAGAAGG - Intergenic
993045769 5:82864637-82864659 ATGGGGAATGTGAGGGAGAACGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993485006 5:88473099-88473121 ATGGGGAAAATGAAGAACTAAGG - Intergenic
993958613 5:94268396-94268418 GTGGGGCAACTGCAAGAGGAGGG + Intronic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995156177 5:108915919-108915941 ATGGGAAAAGTGAAAGAAGAGGG - Intronic
995836839 5:116407770-116407792 ATTGGGAAACTGAGGCAGGCGGG - Intronic
997267535 5:132503950-132503972 CTGGGGAGACTGGAGTAGGAGGG + Intergenic
997379127 5:133422624-133422646 GTGGGGAAAATCAAGGAGGGAGG + Intronic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
998133668 5:139663609-139663631 CTGGGGAAACTGAGGCATGAAGG + Intronic
998667807 5:144318114-144318136 TTGAGGAGACTGAAGGAGAAGGG + Intronic
998771589 5:145551948-145551970 ATGGGGAGACAGAAGGCGGGAGG - Intronic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999443895 5:151623516-151623538 TTGGGGAAGCTGAAGCAAGAGGG + Intergenic
999493345 5:152073012-152073034 ATGGGGAAAGTGGAGGGGTAGGG + Intergenic
999773486 5:154792906-154792928 ATGGGGAAACTGATGGATGTAGG + Intronic
999795785 5:154988664-154988686 AGTGGGAAACAGAAAGAGGATGG - Intergenic
999928734 5:156407721-156407743 GTGGGGGAAATAAAGGAGGAAGG + Intronic
1000109607 5:158095227-158095249 ATAGGAAAACTGATGGAGAAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000919257 5:167119100-167119122 ATGAGGAAACTGAGGCAGAAAGG - Intergenic
1001207488 5:169777941-169777963 ATGAGGAAAATGAAGACGGAGGG - Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001778959 5:174351148-174351170 ATGGGGTAAGTGAAGGAGAGTGG - Intergenic
1001822203 5:174719284-174719306 ATGGGTAAACTGAAAGGGGTGGG + Intergenic
1002177355 5:177408775-177408797 CTGGGGAAACTGAGGAAGGCTGG + Intronic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1003123640 6:3338084-3338106 TGGGGGAAACTGATGGAAGACGG - Intronic
1003145069 6:3503481-3503503 ATTGGGAAGGTGGAGGAGGAGGG + Intergenic
1004100684 6:12607284-12607306 ATTGGGAAATTGAATGGGGATGG - Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1005605772 6:27475662-27475684 ATAGAGAAACTGGGGGAGGAGGG + Intergenic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1005676926 6:28164385-28164407 CTGGGGAAACTGAGGAAGAAGGG - Intergenic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006485269 6:34334696-34334718 TTTGGGAAGCTGAGGGAGGAGGG + Intronic
1006761041 6:36460933-36460955 ATAAGAAAACTGAAGGAAGAAGG - Intronic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008031273 6:46697515-46697537 TTTGGGAAACTGAAGTAGCATGG + Intronic
1008089536 6:47279628-47279650 ATGGGGTAAGTGGAGGGGGAGGG - Intronic
1008137191 6:47790500-47790522 ATGGGGGAGGTGAAGGAGGGAGG - Intronic
1008628175 6:53337960-53337982 TTGGGCAAACTGGCGGAGGATGG + Intronic
1009270775 6:61610706-61610728 ATTGGGAAAATTAAGGAAGAGGG - Intergenic
1009433854 6:63595720-63595742 ATGGTGAAAGTGAAGGAACATGG + Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010874248 6:81081999-81082021 ATAGGGATCCTGGAGGAGGAAGG + Intergenic
1010966327 6:82213545-82213567 ATTGAGAAACTGAAGTAAGAAGG + Intronic
1011216940 6:85015107-85015129 ATAGGGAGACGAAAGGAGGATGG - Intergenic
1011597016 6:89025814-89025836 AAAGGAAAACTGAAGGAGAAGGG - Intergenic
1012399770 6:98834120-98834142 ATGGGGAAACGGAGGGGGTAAGG - Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013233431 6:108176345-108176367 AGAGGGAATCTGAGGGAGGAAGG - Intronic
1013735309 6:113220291-113220313 ATGGGGTATATGAGGGAGGAGGG - Intergenic
1013744842 6:113333573-113333595 ATGGGGAAACTGGAAGGAGAAGG + Intergenic
1014037448 6:116783715-116783737 ATGGGAAAAGTGAGGGAGAAAGG - Intergenic
1015023628 6:128507049-128507071 ATGTGGAAACTGAAGGAAAGTGG + Intronic
1015054690 6:128885978-128886000 ATGTGGAAACTGAAGCATAATGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015447021 6:133317944-133317966 ATGGATCAACGGAAGGAGGATGG - Intronic
1015500068 6:133922621-133922643 ATGAGGAAACTGAAGACGGGAGG + Intergenic
1016070515 6:139733067-139733089 ATGGGGAGAGGGAAGCAGGAAGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018140544 6:160829681-160829703 AGGGAGAAAGGGAAGGAGGAGGG + Intergenic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018452299 6:163920257-163920279 ATGGCAAAACGGAAGGATGATGG - Intergenic
1018501154 6:164412344-164412366 ATGGTGAAAATCAAGTAGGAGGG + Intergenic
1019439982 7:1041122-1041144 ATGGAGAGACTGCAGGAGGGAGG + Intronic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019803699 7:3107005-3107027 ATGAGGAATCTCCAGGAGGAAGG + Intergenic
1020080058 7:5282312-5282334 ATGGGGAAAGCGGAGGAGGGAGG + Intronic
1020201922 7:6086675-6086697 AAGGGGAAAGGGAAGGGGGAAGG - Intergenic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1021123256 7:16820883-16820905 ATGGGGAAAATGATAGATGATGG - Intronic
1021189060 7:17599517-17599539 ATGAGGAAAGTGAAGCAGAAAGG + Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021334313 7:19379885-19379907 ATAGGGAGATGGAAGGAGGAAGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023248943 7:38237056-38237078 ATGGGGAAACTGAGGCAGAGGGG - Intergenic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1025090958 7:56064157-56064179 AGGGGGAAACTGACGGAGCGAGG - Intronic
1025136699 7:56421044-56421066 AAGGGCAAACTGACGGATGATGG + Intergenic
1025280086 7:57620551-57620573 AAAGGAAAAGTGAAGGAGGATGG - Intergenic
1025304647 7:57844950-57844972 AAAGGAAAAGTGAAGGAGGATGG + Intergenic
1025832296 7:65063062-65063084 ATGGGCAAAATGCATGAGGATGG + Intergenic
1025902065 7:65752579-65752601 ATGGGCAAAATGCATGAGGATGG + Intergenic
1025977508 7:66380442-66380464 CTCGGGAAGCTGAAGTAGGAGGG + Intronic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026647431 7:72184327-72184349 ATGGGGAAACTGAGGCATGGAGG - Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026830423 7:73607058-73607080 GGGGGGAAAGTGATGGAGGATGG - Intronic
1026875607 7:73877373-73877395 ATGGGGAGACTGAGGCAGGAAGG + Intergenic
1027293585 7:76742938-76742960 ATGGGGTATCTGTAGCAGGATGG + Intergenic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1028097646 7:86782173-86782195 AGGGTGAAAGGGAAGGAGGAAGG - Intronic
1028198789 7:87936385-87936407 ATGGTAAAACTGAAGAAGCAGGG + Intronic
1028292100 7:89077323-89077345 ATGAGGAAAGTGAAGAAAGAAGG + Intronic
1028322166 7:89473704-89473726 ATGGGAAAACTGATGAAGGTTGG + Intergenic
1028628632 7:92907131-92907153 ATAGGGAAACTGGAAGAGCAGGG - Intergenic
1028920371 7:96304120-96304142 GTAGGGAAACTGTAGGATGAAGG - Intronic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029910215 7:104137765-104137787 TTGGGGAGCCCGAAGGAGGATGG - Intronic
1030278615 7:107745682-107745704 TTGGTGAAAATGAAGGAGAATGG + Intronic
1030648269 7:112088810-112088832 ATGAGGAAACTGAGGGACAAAGG - Intronic
1030898131 7:115086698-115086720 ATTGGGAAAGTGGAGTAGGAAGG + Intergenic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031020287 7:116620451-116620473 AAGTGGAGACTGAAGAAGGAAGG + Intergenic
1031878501 7:127169097-127169119 ATGAGGAAGCTTAATGAGGAAGG + Intronic
1032158195 7:129487948-129487970 ATGGAGAAACTGAAGCACTAAGG + Exonic
1032548289 7:132761761-132761783 ATGGGGAAACTGAGGCAGGGTGG + Intergenic
1033052061 7:138014611-138014633 CTTGGGAAGCTGAAGCAGGAGGG - Intronic
1033281136 7:140007258-140007280 AAGTGGTAACTGATGGAGGAGGG - Intronic
1033568823 7:142606931-142606953 CTCGGGAAACTGAGGCAGGAGGG + Intergenic
1034015882 7:147586033-147586055 AAGGTGAAACTGAAGCAGGAAGG + Intronic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034443661 7:151101004-151101026 ATGGGGGACCTGAAGGTGGTTGG - Intronic
1034780235 7:153872693-153872715 ATGGGGAAACTGAGGCATGGGGG + Intergenic
1034864287 7:154627680-154627702 ATGCGGAAGTTGAAGGATGATGG - Intronic
1034882766 7:154775218-154775240 ATGAGGAAACTGAAGCAGGGAGG - Intronic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1037860401 8:22401033-22401055 ATGAGAAAACTGAAGGTAGAGGG + Intronic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039137362 8:34340339-34340361 ATGTTCAAACTGAAGTAGGAAGG - Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039456797 8:37712596-37712618 ACAGGGAAACAGAAGGAGGTGGG - Intergenic
1040537178 8:48320625-48320647 AAGGGGAAAATAAAGGAGGAAGG + Intergenic
1040868156 8:52071221-52071243 ATAGGGAGAGTGAAGGAAGAGGG - Intergenic
1041563565 8:59248695-59248717 ATGATGAAACTGTAGGAGGGTGG - Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1042036535 8:64540103-64540125 GTGGGGAGACTGAGGTAGGAGGG + Intergenic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042730152 8:71924282-71924304 ATGGGGAAACCCATGGGGGAAGG + Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1043095771 8:75970191-75970213 ATGCAGAAACTCAGGGAGGAGGG - Intergenic
1043097902 8:75999191-75999213 ATGGGGAAAGACAAGGTGGAAGG - Intergenic
1043663400 8:82776117-82776139 ATCTGGAAGCTGAAGGAGTAAGG - Intergenic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1044471592 8:92575511-92575533 ATGGAGACAATGAAGGAAGAAGG - Intergenic
1044540146 8:93399516-93399538 ATGGGGAAGCTGCAAGAAGAGGG + Intergenic
1044621554 8:94195592-94195614 ATGGGAAGCCTTAAGGAGGAAGG - Intronic
1044931693 8:97258017-97258039 ATGTGTAAACTGTAGGGGGAGGG - Intergenic
1045005276 8:97911997-97912019 AAGAGGAAACTGAAGGAGAGAGG + Intronic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045322015 8:101089296-101089318 ATTGGGAGAAGGAAGGAGGATGG + Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045423894 8:102043737-102043759 ATGGGGAAAGGGAAGGGGAAGGG + Intronic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046711660 8:117517798-117517820 ATGGGGCAAGTGTAGCAGGAAGG + Intergenic
1046824214 8:118669624-118669646 TTGGGGAGGCTGAAGCAGGAGGG + Intergenic
1047054313 8:121147175-121147197 TTAGGTAAACTGAAGGAGGAAGG - Intergenic
1047301835 8:123620155-123620177 AATGGGAAACTGGAGCAGGAAGG - Intergenic
1047468608 8:125144669-125144691 AGGGGCAAAATGAAGGAGAAAGG - Intronic
1047489304 8:125361537-125361559 ATGAGGAAACTGAGGCAGAAAGG - Intronic
1047491322 8:125377076-125377098 TTTGGGAAACTGAGGGAGGGTGG - Intergenic
1047549848 8:125858859-125858881 ATGAGGAAACTGAGGCAGAAAGG + Intergenic
1048017053 8:130506844-130506866 TTGGGGAAACCGAAGAAGCAGGG + Intergenic
1048174245 8:132137334-132137356 ATGAGGAAACTGAAGCTGAAAGG - Intronic
1048249974 8:132856752-132856774 ATGGGGAAATTGGAGGATGATGG + Intergenic
1048315035 8:133355551-133355573 ATTGGGGATCTGAAGGAGGCAGG + Intergenic
1048407552 8:134138728-134138750 AATGGGAAACTGAAGGAAGGAGG - Intergenic
1048448772 8:134513026-134513048 ATGGGGCAGCTGACGGTGGAAGG + Intronic
1049061252 8:140277853-140277875 ATGGGCAAACTGTGGGAGGTAGG + Intronic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049399567 8:142418881-142418903 ATGGGGAGACTGAGGCTGGAAGG + Intergenic
1049502448 8:142974658-142974680 TGGTGGAAACTGAAGAAGGAAGG + Intergenic
1049641156 8:143716594-143716616 ATGAGGAAACTGAGGCACGAAGG - Intronic
1050264790 9:3878874-3878896 ATTGGGAAACAGAAGTATGAAGG + Intronic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050715751 9:8523223-8523245 ATGGGGACAGTGGAGCAGGAAGG + Intronic
1050859443 9:10407923-10407945 ATGGGGAAACTTTTGGAAGAAGG + Intronic
1051253700 9:15189725-15189747 ATTTGGAAACTGCTGGAGGAAGG + Exonic
1051556119 9:18384486-18384508 ATGAGGGCATTGAAGGAGGAAGG - Intergenic
1051609215 9:18945132-18945154 AAGGGAAAACTGGAGGAGAATGG - Intronic
1051805153 9:20984241-20984263 ATGGGGAAACTGAAGCACAGTGG - Intronic
1052252466 9:26415035-26415057 ATGGGGAGACTCAGGAAGGAAGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053113875 9:35485213-35485235 ATGGGCAAAGTGTAGGAGGGAGG - Intergenic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053632183 9:39954811-39954833 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1053773582 9:41508724-41508746 ATGGGGAAAGAGAAGGAGATTGG + Intergenic
1054211705 9:62295887-62295909 ATGGGGAAAGAGAAGGAGATTGG + Intergenic
1054313277 9:63552942-63552964 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1054916335 9:70498234-70498256 AGGAGGAAACTGGAGGGGGATGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055106983 9:72523225-72523247 GTGGGGAAAATGAAGGAGAAGGG + Intronic
1055177336 9:73336259-73336281 AGGGGGAAAAGGAAGGAAGATGG - Intergenic
1055499117 9:76885760-76885782 ATGGGGAAACTGAGGTAGAGAGG - Intronic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1056171356 9:83988124-83988146 TTGGGGAAACTGAGGTGGGAGGG - Intronic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056344144 9:85673232-85673254 AGGGGGATAGGGAAGGAGGATGG + Intronic
1056352386 9:85763616-85763638 ATTGGGAGAATGGAGGAGGATGG + Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057115969 9:92522498-92522520 ATGGGGAAAGAGAAGGAGAGAGG - Intronic
1057231547 9:93324535-93324557 ATGGGGAGGCTGGAGGGGGATGG - Intronic
1057236542 9:93366082-93366104 ATGGGGAGGCTGGAGGGGGATGG + Intergenic
1057373072 9:94491483-94491505 ATGGGGAGGCTGAGGCAGGAGGG + Intergenic
1057563314 9:96146077-96146099 ATGGGGGTACTGGTGGAGGAAGG + Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058732566 9:107864394-107864416 TTGGGGGAACTGAAAGATGATGG - Intergenic
1058806186 9:108594344-108594366 ATGAGAAAACTGAGGGATGAGGG - Intergenic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059449596 9:114362158-114362180 ATGGGGAAACTGAGGCTAGATGG - Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061373468 9:130210944-130210966 TTTGGGAGGCTGAAGGAGGAGGG - Intronic
1061430508 9:130527571-130527593 ATGGGGAAACTGAGGCTGGGGGG + Intergenic
1062046723 9:134427769-134427791 AGGGGGAAACTGAGGCATGAGGG - Intronic
1062175420 9:135159407-135159429 ATGGGGAAACTGAAGCCCCAAGG + Intergenic
1062213275 9:135376032-135376054 ATGGGGAAGCTGAACTTGGACGG + Intergenic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1203467798 Un_GL000220v1:104116-104138 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203475623 Un_GL000220v1:148092-148114 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1185823746 X:3229022-3229044 ATGGGGAAACAGGGGGAGTAAGG + Intergenic
1186034469 X:5406131-5406153 AGGAGGAAGATGAAGGAGGAAGG + Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186356803 X:8799600-8799622 ATGGGGGAAGGGGAGGAGGAGGG - Intronic
1186357130 X:8800715-8800737 ATGGGGGAAGGGGAGGAGGAGGG - Intronic
1186561568 X:10618918-10618940 ATGAGGAAAAGGAAGGAGAAGGG - Intronic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1187638320 X:21258842-21258864 ATTGTGAAACTGAAGGAAGATGG + Intergenic
1188277944 X:28224223-28224245 ATGGGCAAACTGAAGTTGGAGGG + Intergenic
1188388619 X:29592032-29592054 ATGGGGAAACTCACACAGGATGG + Intronic
1188755087 X:33952570-33952592 TTGGTGAAAATGAAGGGGGAGGG + Intergenic
1188932235 X:36125870-36125892 ATGATGACACTGAGGGAGGAAGG - Intronic
1189136649 X:38557431-38557453 AGGGGGTAACAGTAGGAGGAGGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189611475 X:42740939-42740961 ATTGGGATCCTGAAGTAGGATGG + Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192126055 X:68501920-68501942 ATGGGGAAACTGAGGCAAGGAGG - Intronic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194852098 X:98881957-98881979 ATGGAGAAACTGATGGAAGTAGG + Intergenic
1195742050 X:108074768-108074790 ATGGGAAAGCTGAAGCATGACGG + Intronic
1196271419 X:113716342-113716364 ATGGGGAACCGGAAGGGGAATGG - Intergenic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196367986 X:114944513-114944535 TTGAGAAAACTGAAGCAGGAAGG - Intergenic
1196657211 X:118230985-118231007 ATAGTGAAAATGAAGGAGCATGG + Intergenic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1197354861 X:125425911-125425933 GTGGGGGAATTGAAGGAAGATGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197816933 X:130507307-130507329 ATGGGGCAACAAAAGAAGGATGG - Intergenic
1198108971 X:133485800-133485822 AAGGGGAAACTGAGGGGGCAGGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199575430 X:149309063-149309085 ATGAGGAAACTGAAGCACAAGGG - Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic