ID: 1138463187

View in Genome Browser
Species Human (GRCh38)
Location 16:57165946-57165968
Sequence TGGACCTGGGTCAGTTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138463187_1138463195 29 Left 1138463187 16:57165946-57165968 CCAGTAAAACTGACCCAGGTCCA 0: 1
1: 0
2: 2
3: 6
4: 97
Right 1138463195 16:57165998-57166020 AGCTTATGTGAGAACTTGAAAGG 0: 1
1: 0
2: 2
3: 12
4: 237
1138463187_1138463192 4 Left 1138463187 16:57165946-57165968 CCAGTAAAACTGACCCAGGTCCA 0: 1
1: 0
2: 2
3: 6
4: 97
Right 1138463192 16:57165973-57165995 CTGCGAGTCCCTAGTCTTGCAGG 0: 1
1: 0
2: 0
3: 0
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138463187 Original CRISPR TGGACCTGGGTCAGTTTTAC TGG (reversed) Intronic
907792156 1:57677451-57677473 TGAACCTGGGTCTGTGTGACTGG + Intronic
910877030 1:91886827-91886849 TGGAGCTAGGTCAGCATTACCGG + Intronic
912561986 1:110557582-110557604 TGGTCATAGGTCAGTTTTCCAGG + Intergenic
914829544 1:151160709-151160731 TTGGCCTGGGGCAGTTTTATTGG - Exonic
916422383 1:164649056-164649078 TGGACCTGGATCATTTTCAGGGG + Intronic
921755023 1:218845484-218845506 TGGGCATGTCTCAGTTTTACAGG + Intergenic
924816298 1:247444936-247444958 TGGGCCTGGGTCAGTTGTGGTGG + Intronic
1068616330 10:59122017-59122039 TGGAGCTGGGACAGCTTTTCAGG + Intergenic
1071585348 10:86815133-86815155 TTGCCATGGGTCAGTTTTATTGG + Intronic
1072706103 10:97682176-97682198 TGTACCTGGGTCAGGGGTACAGG + Intronic
1072976898 10:100066732-100066754 TGGACCAAGGTCAGCTCTACAGG + Intronic
1076591084 10:131583183-131583205 TGGAACTGGGGCATTTTTAGAGG + Intergenic
1076876492 10:133218742-133218764 TGGAGCTGGGTGATTTTAACAGG + Intronic
1081826503 11:46058986-46059008 TGACCCTGGGGCAGTTTTAGGGG - Intronic
1082078708 11:47995437-47995459 TGGACTTGGGCCAGTCTCACAGG + Intronic
1082633135 11:55563759-55563781 TGGGCATGGGGCAGTTTTATAGG - Intergenic
1086072163 11:82811464-82811486 TGGCGCTGGGTCAGTTTTCCTGG + Intergenic
1087722874 11:101686779-101686801 TGGGTCTGAGTCAGTTTAACTGG + Intronic
1101833881 12:108281420-108281442 TGGACCGGGCTCAGTGCTACAGG - Intergenic
1110430587 13:75418375-75418397 TGGATCTGGGACAGTTACACAGG + Intronic
1122711523 14:103662094-103662116 TTGTCCTGGGTCTGTTTTATAGG + Exonic
1124092964 15:26623682-26623704 TGGACCTGGGGCAGTTTAAGCGG - Intronic
1124374862 15:29123567-29123589 TGGCCGTTGGTCAGTTTTCCAGG + Exonic
1124405726 15:29389924-29389946 TGGACCTGTGTCAGTGTTTCCGG - Intronic
1127010197 15:54617297-54617319 TTGACCTGGTTTAGTTTTAATGG - Intronic
1129592395 15:76928803-76928825 TGGCCCTTGGTCAGTTATACTGG - Intergenic
1134566063 16:15252908-15252930 TGAGACTGGGTCATTTTTACAGG + Intergenic
1134736431 16:16503790-16503812 TGAGACTGGGTCATTTTTACAGG - Intergenic
1134825598 16:17281838-17281860 TGGACCTGGGTCAGTCCCTCTGG + Intronic
1134931083 16:18208378-18208400 TGAGACTGGGTCATTTTTACAGG + Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1138463187 16:57165946-57165968 TGGACCTGGGTCAGTTTTACTGG - Intronic
1139833167 16:69817208-69817230 TGAAACTAGGTCAGTTTTAATGG + Intronic
1143523389 17:7458911-7458933 GTGACGTGGGTCAGGTTTACAGG - Intergenic
1149089391 17:52760340-52760362 TGAAACTAAGTCAGTTTTACAGG - Intergenic
1149374662 17:56031969-56031991 TGGACCTGGGGCAGATGTGCAGG + Intergenic
1149568266 17:57654334-57654356 TGGACCTGGAACAGGGTTACAGG + Intronic
1151413748 17:73948126-73948148 TGGACATGGGACAGGCTTACTGG + Intergenic
1152424866 17:80213512-80213534 AGGACCTGGGTCAGATTTGGGGG - Intronic
1155943949 18:31826785-31826807 TGGTGCGGGGGCAGTTTTACGGG + Intergenic
1157321265 18:46636427-46636449 TGGACCTTGATCAGGTTTCCAGG - Intronic
1160047814 18:75403844-75403866 TTGTCCTACGTCAGTTTTACTGG - Intergenic
1160625112 18:80198790-80198812 TGGCCCTGGGTAAGGTTTTCTGG - Intronic
1161377431 19:3947200-3947222 TGGACCTGGCTCAGGTTCCCAGG - Intergenic
1164828293 19:31300560-31300582 TGGACCTGGGCCAGCTCTCCTGG - Intronic
1165374511 19:35432260-35432282 TGGACTTGGGGCATTTTTTCTGG + Intergenic
1166411380 19:42557653-42557675 TGGGGGTGGGACAGTTTTACAGG - Intronic
926637235 2:15195272-15195294 AGGGCCTGCGTTAGTTTTACTGG + Intronic
927327290 2:21819670-21819692 ATGACATGGGTCAGTTTTGCTGG + Intergenic
928763728 2:34615624-34615646 TTGCCCTGGCTCAGTTTTTCAGG - Intergenic
932335818 2:70930881-70930903 TGGAGCTGGGGCAGGTGTACCGG - Intronic
936080148 2:109427559-109427581 TGAACCTGGGCCAGTGGTACTGG - Intronic
937035970 2:118782261-118782283 TGGGCCTGGCTCAGGTTTCCTGG - Intergenic
938561096 2:132472543-132472565 TGGACCTGGGCCTGGTTCACAGG - Intronic
938756481 2:134384395-134384417 TGTAACTGGTTCAGTTTTTCAGG + Intronic
943405474 2:187477945-187477967 TGGAACTGGGTCAGGTATATAGG + Intronic
1169569866 20:6893921-6893943 CGGACCTTGATCAGTTTTATTGG + Intergenic
1170077854 20:12439193-12439215 TGGACCAGGGTCAGTTGGAATGG - Intergenic
1170359588 20:15530319-15530341 TGAACATGGGTCAGTTTTCAAGG + Intronic
1182712730 22:32332633-32332655 GGGAGCTGTGTCAGTTTTAGAGG + Intergenic
949368855 3:3312851-3312873 TGGACCTGGGACTGTTTCAGAGG + Intergenic
949476099 3:4447084-4447106 TGGACCTGGGTAATGCTTACAGG + Intronic
950506888 3:13400559-13400581 TGGGCCTGGGGCAGTTATCCTGG - Intronic
951559347 3:23949977-23949999 TGGACCTGGGCCAGGTTCCCAGG - Intronic
952499368 3:33945541-33945563 TGGGCCTAGTTCAGTTTTTCTGG + Intergenic
953048410 3:39316588-39316610 TGGACCTTTGTCAGTCTTAAGGG - Intergenic
953779023 3:45849643-45849665 TGTACTTGGGTTAGTTTTGCAGG - Intronic
959179122 3:102956141-102956163 GGGACCACGGTCAGTTTAACTGG - Intergenic
960765289 3:121121643-121121665 TGGACCTGGATGAGTCTTAGTGG - Exonic
960810987 3:121627387-121627409 TGGAGCTGGGTCTGTTTTGACGG + Exonic
961122718 3:124386426-124386448 TGGACCGGGGTCAGTTTCCATGG + Intronic
962352641 3:134666924-134666946 AGAATCTGGGTCTGTTTTACCGG + Intronic
964001052 3:151772256-151772278 TGGACTTGGGTCAGTTTCACTGG + Intergenic
964373128 3:156022400-156022422 TGGATCTGGGCCTGTTTTTCTGG + Intergenic
968755671 4:2414701-2414723 TGGACCTGGGAGAGATTTCCTGG - Intronic
968964319 4:3761840-3761862 TGGATCTGGGCCACTTTTGCCGG - Intergenic
977624981 4:99180258-99180280 AGGAGCTAGGTGAGTTTTACTGG - Intergenic
978809351 4:112833056-112833078 TGGACATGGGACAGTTTGAAAGG + Intronic
981272706 4:142863043-142863065 TGTCCCTGGTTCAGTTTTCCTGG + Intergenic
982391694 4:154871597-154871619 TTGAACTGGGTCTGTCTTACAGG - Intergenic
982512021 4:156294691-156294713 TAGAGCTGGGTTAGTTTTCCCGG - Intergenic
982880601 4:160709925-160709947 TGGAATTGGGTCACTTTTAATGG - Intergenic
983657719 4:170099894-170099916 TGGACCTGGCCCAGTGCTACAGG + Intergenic
994691527 5:103025706-103025728 AGTACCTGGGTCAGTTTTTCAGG + Intronic
997347354 5:133201760-133201782 AGGCTCTGGGTCTGTTTTACTGG + Intronic
998640411 5:144004035-144004057 TGGGGCTGAGTCTGTTTTACAGG + Intergenic
1001371921 5:171212872-171212894 TGGAGCTGGGTCAGTTTTCCAGG + Intronic
1001450263 5:171819115-171819137 CAGACCTGGGCCAGATTTACTGG - Intergenic
1015321770 6:131883560-131883582 TGTACTTGGGAAAGTTTTACAGG + Intronic
1015399990 6:132778014-132778036 TAGGCTTGGGGCAGTTTTACAGG + Intronic
1018837768 6:167498124-167498146 TGAAACTGGGTAATTTTTACAGG - Intergenic
1018966289 6:168492024-168492046 TGAACATGGCTCAGTCTTACTGG + Intronic
1034334752 7:150313936-150313958 TGCACCTGGGTAAGTGTTAGTGG + Intronic
1035599831 8:890974-890996 AGGACCTGGGTCAGTGCTATTGG + Intergenic
1035910750 8:3563480-3563502 TGGAGCTCAGTTAGTTTTACAGG - Intronic
1041325523 8:56659403-56659425 TGGGCCTAGGCCAGTTTTAGAGG + Intergenic
1044141017 8:88652929-88652951 TGGTCACGGGTCAGTTTTCCGGG - Intergenic
1045686200 8:104714881-104714903 AGGATTTGGGTCAGTCTTACAGG - Exonic
1047768353 8:128008829-128008851 TGGACCTGGCTGTGTTTTTCAGG - Intergenic
1050059398 9:1689569-1689591 TGGAACAGTGTCAGATTTACAGG + Intergenic
1056940999 9:90956164-90956186 TGGTCCTGGGTGAGCTTTCCAGG + Intergenic
1059446571 9:114341925-114341947 TAGACCTGGGTGAGTTTAACTGG - Intronic
1188898152 X:35695321-35695343 TGGGCCATGGTCAGTTTTATTGG + Intergenic
1188982573 X:36740126-36740148 TGGAACTGGTGCAATTTTACAGG + Intergenic
1194199787 X:90940602-90940624 TTGTCCTGGGCCAGTTTTCCAGG - Intergenic
1200545777 Y:4517018-4517040 TTGTCCTGGGCCAGTTTTCCAGG - Intergenic