ID: 1138465211

View in Genome Browser
Species Human (GRCh38)
Location 16:57185513-57185535
Sequence CTGCTACTCACTTGAAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138465205_1138465211 4 Left 1138465205 16:57185486-57185508 CCTGTTCCAAGACCTCTGGAACG 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1138465211 16:57185513-57185535 CTGCTACTCACTTGAAACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1138465200_1138465211 30 Left 1138465200 16:57185460-57185482 CCGCACATCCGAGTGAGTAACCT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1138465211 16:57185513-57185535 CTGCTACTCACTTGAAACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1138465207_1138465211 -2 Left 1138465207 16:57185492-57185514 CCAAGACCTCTGGAACGGAGCCT 0: 1
1: 0
2: 1
3: 8
4: 83
Right 1138465211 16:57185513-57185535 CTGCTACTCACTTGAAACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1138465208_1138465211 -8 Left 1138465208 16:57185498-57185520 CCTCTGGAACGGAGCCTGCTACT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1138465211 16:57185513-57185535 CTGCTACTCACTTGAAACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1138465202_1138465211 22 Left 1138465202 16:57185468-57185490 CCGAGTGAGTAACCTGGACCTGT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1138465211 16:57185513-57185535 CTGCTACTCACTTGAAACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1138465203_1138465211 10 Left 1138465203 16:57185480-57185502 CCTGGACCTGTTCCAAGACCTCT 0: 1
1: 0
2: 2
3: 27
4: 315
Right 1138465211 16:57185513-57185535 CTGCTACTCACTTGAAACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138465211 Original CRISPR CTGCTACTCACTTGAAACCT GGG Intronic
900529893 1:3148011-3148033 CTGCTGCTCACCTGCAACTTGGG + Intronic
911220941 1:95245184-95245206 CTTCTACTAACATGAAATCTCGG - Intronic
911429717 1:97769158-97769180 CTGCTACTTAATGGAAATCTAGG - Intronic
915970962 1:160354825-160354847 CTGCTCCTAACTTGAGGCCTTGG + Intronic
919474004 1:198011960-198011982 CTGCTACCCACTGGTGACCTCGG - Intergenic
920949155 1:210556467-210556489 CTGCTGCTCACCTGAACCCCAGG + Intronic
923413523 1:233732754-233732776 ATGAAAATCACTTGAAACCTGGG + Intergenic
923537475 1:234864155-234864177 CTCCCACTCACTTCATACCTTGG + Intergenic
1063755117 10:8998577-8998599 CAGCTGCCCACTTGAAAACTTGG - Intergenic
1064196494 10:13247839-13247861 GTACTACTCACTCCAAACCTTGG - Intergenic
1065083910 10:22155074-22155096 CTGCTAATGACCTGAGACCTGGG + Intergenic
1066036378 10:31491376-31491398 CTGCTACTACCTTGAAGGCTAGG + Intronic
1066286323 10:33969668-33969690 CTGCTTCCACCTTGAAACCTGGG + Intergenic
1069753488 10:70759917-70759939 CTGCTGCACACTGGAATCCTTGG - Intronic
1072488336 10:95877989-95878011 CTGCTAGCTACTGGAAACCTAGG + Intronic
1081078771 11:38712360-38712382 CTGGTAATGACTAGAAACCTTGG - Intergenic
1086941632 11:92804067-92804089 CTGCTACTTCATTGAAAACTTGG - Intronic
1088652411 11:111969564-111969586 CTGTTCCTCCCTTGAAGCCTGGG - Intronic
1089713191 11:120332167-120332189 TTGCTACTCACTTGCCACTTTGG + Intronic
1096172468 12:49483507-49483529 CTGCTACTCAAATGAAAAATCGG - Intronic
1096759884 12:53832338-53832360 CTGCAGCTCACCTGAGACCTGGG - Intergenic
1097231392 12:57513795-57513817 CTGCTACTCACTTTCAGCTTTGG + Intronic
1098753674 12:74329109-74329131 ATGCTAGTCACTTGAAACAGAGG + Intergenic
1099601889 12:84750101-84750123 CTGTTGATCACTTAAAACCTTGG + Intergenic
1100703905 12:97179647-97179669 CTCCTACTTACTTGAAGCTTAGG + Intergenic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1105999940 13:25712351-25712373 CTGCTGCCCACTAGAAACCCTGG + Intronic
1106370223 13:29125342-29125364 CAGCTACTCATTTTAAACCAAGG - Intronic
1108129679 13:47284769-47284791 CTGCTATTCACTAGCAACCATGG + Intergenic
1108732665 13:53251181-53251203 CAGTTCCTCACTTCAAACCTTGG + Intergenic
1109141805 13:58721847-58721869 CTGCTACTAACACAAAACCTAGG + Intergenic
1112359673 13:98706123-98706145 CTTCTACTTACTTGAGACATTGG + Exonic
1113535384 13:111062284-111062306 CTGCCACCCACTCTAAACCTTGG - Intergenic
1113830643 13:113293022-113293044 ATGAGAATCACTTGAAACCTGGG - Intergenic
1113977624 13:114241322-114241344 CTGCCAATTACTTGTAACCTCGG - Intronic
1114494455 14:23123102-23123124 CTGCCAGTCACTTTAATCCTAGG - Intergenic
1119129375 14:72157388-72157410 CTGTTACTCGCTTGAAACTAGGG + Intronic
1122176117 14:99920398-99920420 CTGCTTCGCCCTGGAAACCTGGG + Intronic
1133966052 16:10532391-10532413 CTGCTTCTCACTTGGAACTTGGG + Exonic
1138465211 16:57185513-57185535 CTGCTACTCACTTGAAACCTGGG + Intronic
1140059595 16:71556466-71556488 CTGTTACTCTCTTGCAAGCTTGG - Intronic
1140554477 16:75905760-75905782 GGGCTATTCACCTGAAACCTTGG + Intergenic
1145868383 17:28255263-28255285 CTGCTGCTCTCTGGGAACCTGGG - Intergenic
1148948905 17:51291413-51291435 CTGCTACTGACTTGGAATATCGG - Intronic
1149514145 17:57267294-57267316 CTGCTACTGACTTGGAACATAGG - Intronic
1150972202 17:70041453-70041475 CTGCTCCTGAATTTAAACCTGGG + Intergenic
1151123659 17:71821405-71821427 CTGATACTCAGTTGAAATGTTGG - Intergenic
1155911238 18:31506472-31506494 CTGCTTCCCACTTTAGACCTTGG + Intronic
1157117775 18:44878402-44878424 ATTCTGCTCACTTGAGACCTGGG + Intronic
1157180504 18:45493862-45493884 CTGCTTTTCACTTGAAACTTTGG + Intronic
1157745283 18:50129677-50129699 CTGCTACTCCCTAGGGACCTCGG - Intronic
1166620813 19:44298437-44298459 CTGCTACTGCATTGCAACCTGGG - Intronic
1167548946 19:50146386-50146408 CTGAGAATCACTTGAAACCCGGG - Intergenic
1167750146 19:51374537-51374559 CTGCTACTCACTGCACACCATGG - Intergenic
929465605 2:42141178-42141200 CTGCTTATCACTTGAATCCCAGG - Intergenic
929581357 2:43083439-43083461 CGGGGACACACTTGAAACCTCGG - Intergenic
929718700 2:44342755-44342777 CTGATAACTACTTGAAACCTTGG - Intronic
933366148 2:81356916-81356938 CTGCCCCTCACTTGAAATTTAGG + Intergenic
933938759 2:87228113-87228135 CTGCTTCTCTCTTGAAGCCTGGG + Intergenic
935352428 2:102164136-102164158 CTGATACTCAGCTGAAAACTTGG + Intronic
936354377 2:111737662-111737684 CTGCTTCTCTCTTGAAGCCTGGG - Intergenic
940396283 2:153196142-153196164 CTGCTAGTCCCAAGAAACCTGGG - Intergenic
941938571 2:171008551-171008573 CTTCTACTCACCTGAAATTTTGG - Intronic
942688861 2:178563857-178563879 CTGTACCTCAGTTGAAACCTGGG + Exonic
943089599 2:183358151-183358173 ATGGTAGTCACTTGAAACCTAGG + Intergenic
943562592 2:189481896-189481918 TTGCTACTTAATTGCAACCTTGG + Intergenic
1169830421 20:9819284-9819306 CTGCTTCTATTTTGAAACCTTGG - Intronic
1170454657 20:16520629-16520651 CTGCTGCTCTCTTCAGACCTGGG - Intronic
1177098798 21:16873455-16873477 CTCCCACCCGCTTGAAACCTGGG - Intergenic
1184549248 22:45195747-45195769 CAGCCACACACTTGAACCCTGGG + Intronic
951224844 3:20109013-20109035 CTACTACACACTTGGCACCTAGG - Intronic
951247801 3:20361310-20361332 CTGCAACTCAGCAGAAACCTAGG + Intergenic
952826653 3:37530197-37530219 CTGCTGCTCAGCTGAATCCTGGG - Intronic
956414697 3:69013660-69013682 CTGCCGCTCACCGGAAACCTCGG + Exonic
965149930 3:164959801-164959823 ATGCAATTGACTTGAAACCTGGG - Intergenic
967820398 3:193834355-193834377 CTGCTGCTCCTTTGGAACCTGGG + Intergenic
967940250 3:194760617-194760639 CTGATTCTCACTGGAAAGCTCGG + Intergenic
993724148 5:91349198-91349220 CAGTTACAAACTTGAAACCTTGG - Intergenic
995753796 5:115480315-115480337 CTGCTACTATCTTGAAGCCCTGG + Intergenic
997395180 5:133553980-133554002 CTGCTACTCACTAGCCCCCTGGG + Intronic
999799989 5:155024524-155024546 CAGCTATTAACATGAAACCTAGG - Intergenic
1008198989 6:48562958-48562980 TTGATCCTCACTTGAAAACTGGG + Intergenic
1009508449 6:64517240-64517262 CTGGTACTCACTAGAAATCTGGG - Intronic
1009576899 6:65476141-65476163 CTGCTCCTGAAGTGAAACCTTGG + Intronic
1009877729 6:69526712-69526734 CTGCTACTCTGTTAAAACATAGG - Intergenic
1010524654 6:76885831-76885853 CTGCTACTCAGTTGTCACCCAGG - Intergenic
1012280309 6:97320700-97320722 CTGCTACTGAATGGAAACATGGG + Intergenic
1013806429 6:114000809-114000831 TTGATTCTCACTAGAAACCTTGG - Intronic
1013833461 6:114302465-114302487 CTGCTACTTAAGTAAAACCTAGG + Intronic
1015129330 6:129792340-129792362 CTGCTCCTCACATGAGACCATGG - Intergenic
1016208364 6:141497916-141497938 ATACTACTCACTTTAAACTTTGG - Intergenic
1016415443 6:143828280-143828302 GTGCTACTTCTTTGAAACCTGGG - Intronic
1019037391 6:169072911-169072933 CTGCCATTCTCTTCAAACCTTGG - Intergenic
1022233387 7:28436978-28437000 CTTCTTCTCCTTTGAAACCTGGG - Intronic
1022727526 7:32994600-32994622 CTGCTACTCACTCAAAACAGGGG - Intronic
1024985664 7:55191428-55191450 CTGCTGCCCAGTTGAGACCTGGG - Intronic
1025046060 7:55693049-55693071 CTGCTACTCACTCAAAACAGGGG + Intergenic
1028735503 7:94207490-94207512 CTGCAATTCACTGGAAACTTAGG - Intergenic
1028840863 7:95428971-95428993 CTACTATTTACCTGAAACCTTGG - Intronic
1033367837 7:140684856-140684878 CAACTACTGAATTGAAACCTAGG - Intronic
1036492842 8:9243870-9243892 CTCCTGCTCAGTTGAAGCCTTGG + Intergenic
1043523452 8:81071728-81071750 GTGCTACTTACTTGTAACTTGGG - Intronic
1044863483 8:96546256-96546278 GGGCAACTCACTTGAAACTTTGG + Intronic
1048588571 8:135799616-135799638 CTAATATTTACTTGAAACCTGGG + Intergenic
1048666618 8:136669147-136669169 CTGGAACTCACTGTAAACCTAGG + Intergenic
1050646514 9:7725368-7725390 TTGATATTCACTTGAAACATTGG + Intergenic
1055373753 9:75626606-75626628 CTCATACTCACTTGAAAGGTAGG - Intergenic
1056089670 9:83192953-83192975 CTGTTTCTCACTAGAATCCTGGG - Intergenic
1056459575 9:86796819-86796841 ATACTGCTGACTTGAAACCTGGG + Intergenic
1056503749 9:87236599-87236621 CTGATATTCTCTTGAAACCAAGG + Intergenic
1057009030 9:91585161-91585183 CTGCTTCTCACATGTAACATGGG + Intronic
1057069133 9:92080859-92080881 GTGCTACTCACCTTAACCCTAGG + Exonic
1057480735 9:95443503-95443525 ATGCTTCTCATTTCAAACCTTGG - Exonic
1060778744 9:126396058-126396080 CAGCAACTCATTTGAAACCCAGG + Intronic
1060846680 9:126842823-126842845 CTGCTCCCCACTTGGGACCTGGG + Intergenic
1061283980 9:129612054-129612076 CTGCCACATACCTGAAACCTGGG - Intronic
1186115949 X:6305286-6305308 CTGCTACCATCTTGTAACCTAGG - Intergenic
1190557624 X:51652381-51652403 CAGAAACTCACTTTAAACCTAGG - Intergenic
1191754703 X:64581181-64581203 CTGCTACTCACCTCAACCCCAGG - Intergenic
1194892505 X:99397954-99397976 CTGATGCTCACTTAAAACCAAGG + Intergenic
1196501674 X:116390515-116390537 TTGCAACTCACTTCAAGCCTTGG - Intergenic
1199395272 X:147330197-147330219 TTGCTACTCACGTGATACTTAGG - Intergenic
1199805912 X:151300218-151300240 TTGCTACTCACTTGTGACTTTGG - Intergenic