ID: 1138467458

View in Genome Browser
Species Human (GRCh38)
Location 16:57202028-57202050
Sequence TTATCTCAGAGGGGCCGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138467458 Original CRISPR TTATCTCAGAGGGGCCGAGC AGG Intronic
902812935 1:18899375-18899397 TGATGTCAGACGGGCTGAGCTGG + Intronic
902838728 1:19062226-19062248 GAATCTCAGAGGGGTCGAGGAGG - Intergenic
904080313 1:27868415-27868437 TTGTCTCAGAGGGGCCATGCAGG + Intergenic
905227194 1:36486956-36486978 TTGTTTCAGAGGGGCCGGGGCGG + Intergenic
905695627 1:39971509-39971531 TTATCTCAGAGTCTCTGAGCAGG - Intergenic
911160294 1:94677028-94677050 CTATCCCTGAGGGGCCGAGCTGG - Intergenic
915724861 1:158010194-158010216 TGATTTCAGAGGGCCAGAGCAGG + Intronic
915839642 1:159203935-159203957 TTCTCACTGAGGGGCAGAGCTGG - Intronic
916502873 1:165401495-165401517 TTATCACAGATGGGTCGAGAAGG - Intronic
1062864176 10:835968-835990 TTCTCTAAGAGTGGCCGTGCTGG + Intronic
1065818990 10:29507857-29507879 TTATCAGAGCGGGGCCGGGCAGG + Intronic
1065953830 10:30676065-30676087 TTATCAGAGCGGGGCCGGGCAGG - Intergenic
1066304582 10:34128255-34128277 TTGTCTCAGAGTGGCAGAGGTGG - Intronic
1069021351 10:63491933-63491955 TAAACTAAGAGGGGCAGAGCGGG + Intergenic
1080207661 11:29749457-29749479 TTCTCTCAGAGAGGCAGAACTGG + Intergenic
1080483142 11:32673975-32673997 TTATCTCAGAGGGAAGGAACAGG + Intronic
1081852193 11:46281501-46281523 TTTTCTCAGAGGGGAGCAGCAGG + Intronic
1082189054 11:49219893-49219915 TTATCTCTGAGGGGGCAAGCTGG + Intergenic
1083895100 11:65616027-65616049 ATTGCTCCGAGGGGCCGAGCCGG - Exonic
1086677469 11:89626730-89626752 TTATCTCTGAGGGGGCAAGCTGG - Intergenic
1102032782 12:109752680-109752702 TCATCACAGAGGGCCAGAGCTGG - Intronic
1102532988 12:113560342-113560364 TATTCTCAGAGGAGCCCAGCAGG - Intergenic
1102537003 12:113589183-113589205 TTCTCACAGAGGGGCAGGGCAGG - Intergenic
1103280038 12:119749993-119750015 TTATTTCAGAGCAGCCGAGAAGG - Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1107935473 13:45341805-45341827 TTATTCCCCAGGGGCCGAGCAGG - Intergenic
1110454601 13:75677100-75677122 TTAACTCAGAGAGACAGAGCTGG + Intronic
1126317881 15:47390141-47390163 TGATCTCAGTGGGGCTTAGCTGG + Intronic
1127663788 15:61124419-61124441 TGCTCTCAGAGGGGCAGAGAGGG - Intronic
1133203088 16:4216744-4216766 TCCCTTCAGAGGGGCCGAGCTGG + Intronic
1138467458 16:57202028-57202050 TTATCTCAGAGGGGCCGAGCAGG + Intronic
1139891758 16:70257582-70257604 TTGTCTCAGAGCCCCCGAGCAGG - Intronic
1143619009 17:8070589-8070611 AGATTTCAGAGGGGCTGAGCTGG - Intergenic
1148826647 17:50398805-50398827 TTATCTCAGAGGGGCCGAGCAGG + Intergenic
1158613855 18:58968167-58968189 TTATCTCTAAGGGGCCCAGAAGG + Intronic
1158724550 18:59958201-59958223 TTATCTCTGCTGGGCTGAGCAGG + Intergenic
1161268518 19:3376180-3376202 GCATCTTAGAGGGGCCGAGGCGG + Intronic
1161860682 19:6795977-6795999 TGATCTCAGAGTGGACTAGCCGG - Intronic
1163064320 19:14782020-14782042 TAATCCCAGAGAGGCCGAGGTGG + Intergenic
1163179992 19:15592520-15592542 TGATCACAGGGTGGCCGAGCTGG + Intergenic
1164389446 19:27805404-27805426 TAAGCTCAGAGGGGCCGTGAGGG - Intergenic
1165444893 19:35851304-35851326 CCATCTCAGAGCGGCCGACCTGG + Exonic
1166181609 19:41112974-41112996 TGTTCTCAGAGGGGCAGAGGAGG - Intergenic
1167328042 19:48837033-48837055 GTGTCTCTGAGGGGCAGAGCTGG - Intergenic
928785058 2:34874146-34874168 TTATCTCTGAGGGCCAGAGCAGG + Intergenic
930882691 2:56289973-56289995 TTATCCCAGAGGGGTCGAGGTGG + Intronic
937797988 2:126048102-126048124 TTGTCCCAGAGGGGCCCAGCAGG - Intergenic
942480445 2:176382078-176382100 TTATCTCAGAGATGCTGAGCTGG + Intergenic
1174048319 20:47749499-47749521 GGATCTCAGAGAGGCTGAGCTGG + Intronic
1180078632 21:45475939-45475961 TTTTCTCAGGTGGCCCGAGCTGG - Intronic
953818550 3:46183615-46183637 TAATTTCAGCGGGGCCAAGCAGG - Intronic
961629925 3:128289138-128289160 ATTTCTCAGAGGGGCCCAACTGG - Intronic
961657152 3:128449500-128449522 TTATCACAGATGGGCCAGGCTGG + Intergenic
962421005 3:135229241-135229263 TTATCTCAGAGGGGCGTATGAGG - Intronic
969689018 4:8694134-8694156 TTCTCACAGTGGGGCAGAGCAGG - Intergenic
972018453 4:34277030-34277052 TTATCTCAGAGATGCAGAGATGG - Intergenic
975438424 4:74381570-74381592 ATATGTCAGAGGTGCAGAGCAGG + Intronic
978067655 4:104425308-104425330 TTATTTCACAGGCACCGAGCCGG - Intergenic
979962504 4:127037162-127037184 TTATCCCACTGGGGCTGAGCAGG + Intergenic
985546086 5:509893-509915 GCATCTCAGAGGGGCCCTGCGGG + Intronic
995946462 5:117652998-117653020 GTGTCTCACAGGGGCAGAGCGGG - Intergenic
996652863 5:125902246-125902268 TTTTCTCAGATGGGACGAGAGGG + Intergenic
1002069128 5:176668440-176668462 TTGTCTAAGGGGGTCCGAGCTGG + Intergenic
1002358018 5:178646568-178646590 TGATCTTGGAGGGGCCCAGCTGG - Intergenic
1007263373 6:40579288-40579310 TTATGTCACAGGGGCTGAGCTGG - Intronic
1013921769 6:115414435-115414457 CTATCTCAGAATGGCCCAGCTGG + Intergenic
1017585005 6:155910573-155910595 TTATCTCAGAGGGATATAGCAGG + Intergenic
1022192467 7:28030016-28030038 TTATATCAGAGTGTCAGAGCAGG + Intronic
1031187491 7:118501268-118501290 TTGTATCAGAGAGGCTGAGCAGG - Intergenic
1038831215 8:31062789-31062811 TTATCTCAGAGGGGCACAGAGGG - Intronic
1039891416 8:41688207-41688229 TTCTCTCAGTGGGACAGAGCAGG - Exonic
1044895336 8:96885739-96885761 TAATCTCAGGGAGGCCGAGGCGG + Intronic
1046624176 8:116559660-116559682 ATCTCTCAGAGGGGCGGAGATGG - Intergenic
1049045261 8:140145598-140145620 TTATCTCAGAGGTGCAAAGATGG - Intronic
1049444270 8:142622840-142622862 TGAGCTCAGAGGAGCCGTGCCGG + Intergenic
1051454144 9:17234200-17234222 TTATCTCAGCGGGGCCAAGCTGG + Intronic
1059308219 9:113371101-113371123 TTATGTCAGAGGGGGCCATCAGG - Exonic
1061926935 9:133810533-133810555 TTATCTCAGAGGACCCTGGCAGG + Intronic
1197224810 X:123946141-123946163 TAATCCCAGAGAGGCCGAGGCGG - Intergenic