ID: 1138473873

View in Genome Browser
Species Human (GRCh38)
Location 16:57259219-57259241
Sequence TGGTACAAAGAGATGGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138473873_1138473876 -7 Left 1138473873 16:57259219-57259241 CCATGACCCATCTCTTTGTACCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1138473876 16:57259235-57259257 TGTACCAGCTAAAGAAACACAGG 0: 1
1: 0
2: 1
3: 20
4: 249
1138473873_1138473883 29 Left 1138473873 16:57259219-57259241 CCATGACCCATCTCTTTGTACCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1138473883 16:57259271-57259293 TGTGGTCCAGGGCCAAGCCCAGG 0: 1
1: 1
2: 8
3: 37
4: 340
1138473873_1138473880 18 Left 1138473873 16:57259219-57259241 CCATGACCCATCTCTTTGTACCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1138473880 16:57259260-57259282 ACTCCTCCAAGTGTGGTCCAGGG 0: 1
1: 1
2: 24
3: 147
4: 641
1138473873_1138473879 17 Left 1138473873 16:57259219-57259241 CCATGACCCATCTCTTTGTACCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1138473879 16:57259259-57259281 TACTCCTCCAAGTGTGGTCCAGG 0: 1
1: 1
2: 7
3: 50
4: 288
1138473873_1138473878 11 Left 1138473873 16:57259219-57259241 CCATGACCCATCTCTTTGTACCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1138473878 16:57259253-57259275 ACAGGCTACTCCTCCAAGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138473873 Original CRISPR TGGTACAAAGAGATGGGTCA TGG (reversed) Intronic
902272775 1:15316624-15316646 TGCAAGAAAGAGATGGGTGAAGG + Intronic
905970039 1:42134896-42134918 TGGGCCCAAGAGATGGATCATGG + Intergenic
906200049 1:43954185-43954207 TGGCACAAAGAGAAGGGGCAGGG - Intronic
907745894 1:57213175-57213197 AGGTACAAAGAAATGGGGGATGG + Intronic
908343716 1:63209349-63209371 TGATACAAAGTTGTGGGTCACGG - Intergenic
909254093 1:73396210-73396232 TGAAAAAAAGAGATGGGTAACGG - Intergenic
909961274 1:81846612-81846634 AGATACAAAGAGATGGGTACAGG - Intronic
911933408 1:103933934-103933956 TGGTGTAAAGAGATTAGTCAAGG + Intergenic
914826665 1:151142463-151142485 TTGTTCACAGAGATGGGGCAAGG + Intronic
914991210 1:152501138-152501160 TGGTACATAGAGTTTGGTCCAGG + Intergenic
915254542 1:154616365-154616387 GGGGACAGAGAGATGGGGCATGG - Intronic
915943049 1:160130822-160130844 TGGGACAAAGAGCTGTGCCAGGG - Intronic
916087706 1:161282785-161282807 TGTGAGAAAGAGAGGGGTCAAGG - Intronic
918011701 1:180592867-180592889 TGTTACACAGTGATGGGTAATGG + Intergenic
918743822 1:188172480-188172502 TGCAACAAAGAGAAGGGTTAGGG + Intergenic
923777317 1:236991260-236991282 AGGCACAAAGAGATGAGTCAGGG - Intergenic
1065061083 10:21901232-21901254 AGGTACAAAGAAAGGGGTCAAGG + Intronic
1067662453 10:48246659-48246681 TGGTCCAAGGAGAGGGGTCTGGG + Intronic
1075638627 10:124048555-124048577 TTGTAGCAAGCGATGGGTCAGGG - Intronic
1076561409 10:131367951-131367973 TGGGACAAAGACGAGGGTCAGGG - Intergenic
1077897745 11:6466195-6466217 TTGTGCTAAGAGGTGGGTCAGGG - Intronic
1078881382 11:15452302-15452324 TTTTAGGAAGAGATGGGTCAAGG + Intergenic
1079062351 11:17260369-17260391 TGATACAAAGAGATGTGCAAAGG - Intronic
1079132486 11:17755586-17755608 TGACAGAAAGAGATGTGTCAAGG + Intronic
1080052169 11:27869014-27869036 TGCTCCAGAGAGCTGGGTCAAGG - Intergenic
1082212082 11:49517514-49517536 TGGTAGAAATAAATGGGACAAGG + Intergenic
1085314806 11:75538284-75538306 TGAGACAAAGAGATGAGTCAAGG + Intergenic
1086326685 11:85708664-85708686 TGGTGGAAAGAGATGGGTTCAGG + Intronic
1086658923 11:89390998-89391020 TGCTATAAAGAGATGGGGGAAGG + Intronic
1089196172 11:116695094-116695116 TGGAACACAGAGCTGGGTGATGG - Intergenic
1089999011 11:122937586-122937608 TGGTACAAGGACAGGGGACAGGG + Intronic
1091013863 11:132031531-132031553 TGAGATAAAGAGATGGGTCAAGG + Intronic
1092205294 12:6611117-6611139 TGGTACAAAGAAATGAGTTCAGG + Intergenic
1093374615 12:18409710-18409732 TGTGAAAAAGAGATGTGTCAAGG + Intronic
1094318988 12:29164460-29164482 TGGTACCAAGAGTTGGGCTAGGG - Intronic
1096790979 12:54044755-54044777 TGGTACATAGAGATGTGAGAAGG - Intronic
1098217087 12:68232301-68232323 TTGTTCAAAGACATGGGTCAAGG - Intergenic
1098759670 12:74407343-74407365 TAGTACATAGAGATGAGTCATGG + Intergenic
1101207108 12:102499464-102499486 TGGGGTAAAGTGATGGGTCACGG - Intergenic
1102007786 12:109599515-109599537 TGGTGCACAGAGCTGGCTCAAGG + Intergenic
1102046711 12:109833848-109833870 TGGCCCATAGAGATGGTTCAGGG + Intergenic
1104505472 12:129327926-129327948 TGGTACAAGGAGATGAGTTCAGG - Intronic
1107262583 13:38512791-38512813 GGGTACAGTGAAATGGGTCAAGG + Intergenic
1108681618 13:52785511-52785533 TGTTAAAAAGACATGGCTCAAGG - Intergenic
1112958810 13:105095846-105095868 AGGTAGAAAGAGAAGGGTGAGGG + Intergenic
1121702843 14:95968965-95968987 TGGCCCAGAGAGATGGGTCCTGG + Intergenic
1122084699 14:99291465-99291487 TGGGAGAAAGAGAAAGGTCAGGG - Intergenic
1123680057 15:22756733-22756755 TAAGACAAAAAGATGGGTCACGG + Intergenic
1124332269 15:28831186-28831208 TAAGACAAAAAGATGGGTCACGG + Intergenic
1127708220 15:61568046-61568068 TGGTACCATGAGATGGGCCTGGG + Intergenic
1128394152 15:67206779-67206801 TGGTACCAAGAGATGCTCCAGGG + Intronic
1128662291 15:69510912-69510934 TGGAACAAAAAGATGGGGGAAGG + Intergenic
1129242469 15:74259685-74259707 AGGTGCAAAGAGGTGGGTAAAGG - Intronic
1130199844 15:81814773-81814795 TAGGTGAAAGAGATGGGTCAGGG + Intergenic
1134416695 16:14049454-14049476 TGCTAAAAAGAGTTAGGTCAAGG + Intergenic
1137300850 16:47145928-47145950 TGGTATAAAGAGGTTGGACATGG + Intergenic
1137661925 16:50214754-50214776 TGGTACAGAGAGATGGAAAAGGG + Intronic
1138473873 16:57259219-57259241 TGGTACAAAGAGATGGGTCATGG - Intronic
1139132527 16:64163643-64163665 TGTAACAAAGCGATGAGTCAGGG - Intergenic
1141185621 16:81784925-81784947 TGGTACAGAGTGAGGGCTCAGGG + Intronic
1143432587 17:6898174-6898196 TGGAAGAAAGAAATGGGACATGG - Intronic
1143471374 17:7177967-7177989 GAGGACAAAGAAATGGGTCAAGG + Intronic
1144450252 17:15371194-15371216 AGGTGAAAAGAGATGGGTAAAGG - Intergenic
1145879880 17:28345221-28345243 GGGTAGAAAGACATGGGTCAAGG - Exonic
1146550639 17:33777524-33777546 TTGTTCAAACAGATGTGTCATGG - Intronic
1147153843 17:38533433-38533455 TGGAACAAAAACAGGGGTCAGGG + Intronic
1147568330 17:41551435-41551457 AGGTACAAAAAGTTGGGGCAGGG - Intergenic
1147786537 17:42982275-42982297 TGGTGAAAAGGGATGGGGCATGG - Intronic
1150678068 17:67261932-67261954 TGGGGCAAAGAGATGAGTTAGGG - Intergenic
1150944077 17:69725079-69725101 TGGTACATAAAGGTGGGCCATGG - Intergenic
1151397624 17:73834506-73834528 AGGGCCAAAGAGATGGGTGAGGG + Intergenic
1152334315 17:79691707-79691729 TGGGACACAGAGCTGGGCCAGGG + Intergenic
1153283677 18:3437679-3437701 TGGTTCAAAGAGATGCTTCTTGG + Intronic
1157699372 18:49751316-49751338 GGGTTCAAAGAGATGAGACATGG - Intergenic
1158106050 18:53885983-53886005 TGGTCCAGTGAGATGGGGCAAGG + Intergenic
1162905674 19:13822122-13822144 TGTTTTAAAGAGATGGGCCAAGG - Intronic
1163281295 19:16319658-16319680 GGGGACACAGAGATGAGTCAAGG + Intergenic
925123510 2:1437771-1437793 CTGAACACAGAGATGGGTCAGGG + Intronic
926233154 2:11019969-11019991 TGGTACAAGCTGATGGGGCAGGG + Intergenic
926509675 2:13759288-13759310 TGGCACTGAGAGATGGGTGAGGG + Intergenic
926524869 2:13967250-13967272 TGGGACAAAGATGTTGGTCAAGG + Intergenic
927020367 2:19010441-19010463 TGGTACAAAGAGATGCTGCAGGG - Intergenic
927631376 2:24777096-24777118 TGCTGCAAAGAGAGGGGTCCCGG + Intergenic
928907216 2:36381010-36381032 TGGGACAAAGTCATGGGGCAGGG - Intronic
931120528 2:59213545-59213567 TGGGACAAAGATTGGGGTCATGG - Intergenic
932388330 2:71359435-71359457 TGGTACAAATAGATGGAAGAAGG - Intronic
933671608 2:85013032-85013054 TGGTATGAAGAGTTGTGTCAGGG + Intronic
934323133 2:91984445-91984467 TGGAACAAAGACAGGGGTAAAGG - Intergenic
935960215 2:108418538-108418560 AGGGACAAAGATATGGGACAAGG - Intergenic
936744437 2:115557723-115557745 TGGTAAAGAAAGATGGATCAAGG + Intronic
938052992 2:128192052-128192074 TGGTAGAAAGACATGGGGAAAGG - Exonic
938383461 2:130849141-130849163 TGGGACACTGAGAGGGGTCACGG - Intronic
939553431 2:143643799-143643821 TGGAAGAAATAGATGGGTTAGGG + Intronic
940844226 2:158622564-158622586 AGGTACACAGCAATGGGTCACGG + Intronic
942428638 2:175885240-175885262 TGGTACCCAGATATGGGGCAAGG + Intergenic
942497261 2:176552880-176552902 TGGTCCAGAGAGATGTCTCAAGG + Intergenic
942686986 2:178543219-178543241 TGGCACAGAGAGATGGATGAAGG - Exonic
943049599 2:182899169-182899191 TGGGACCAAGAAATAGGTCAGGG - Intergenic
943383533 2:187177004-187177026 TGGGACAAAAAGATGTCTCAGGG + Intergenic
945493679 2:210484307-210484329 TGGAGCACAGAGAGGGGTCAAGG + Intronic
945543549 2:211120524-211120546 TGGAAGAAAGAGATGAGTCAAGG + Intergenic
948858540 2:240741908-240741930 TGGTAGACAGAGGTGGGTGAAGG - Intronic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1169870269 20:10241586-10241608 TGGTCGAGAGAGACGGGTCAGGG + Intronic
1170051314 20:12148723-12148745 TGGTAGTAAGTGATGGGGCAAGG + Intergenic
1172941291 20:38656538-38656560 GGGTACAAAGGGAGGGGTCTGGG - Intergenic
1173186094 20:40841381-40841403 TGGGACAAAGGTATGTGTCATGG + Intergenic
1173223148 20:41145801-41145823 TGGTCCCAAGAGATGGGACTTGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1181771453 22:25128681-25128703 GGGTGCAAAGAGATGGGGCTGGG - Intronic
1182038595 22:27218819-27218841 TGGGAAAACGAGATGGGGCAGGG + Intergenic
1183150350 22:36032138-36032160 TAATACTAAGAGATGTGTCAGGG - Intergenic
1183520741 22:38294873-38294895 TGGTACACAGAGGGGGGCCAGGG - Intronic
1183788861 22:40048767-40048789 TGATACAAAGGGATGGGACAAGG - Intronic
1184219234 22:43088641-43088663 CGGTACAAAAAGATGGGCCCCGG - Intronic
952090445 3:29878510-29878532 TGCTACAACCAGAAGGGTCAAGG - Intronic
953369285 3:42373488-42373510 TTGTACTAAGAGCTGGGTAAGGG - Intergenic
955581215 3:60425082-60425104 TGGTAGAAACACATGGATCAAGG + Intronic
959224473 3:103562592-103562614 TGGTACAAATACATGAATCATGG + Intergenic
959611769 3:108302991-108303013 AGCAACAAAGAGATGGGGCATGG - Intronic
960701179 3:120440901-120440923 TGGTACAGAGAGCTGGCTCCAGG + Intronic
960749494 3:120931501-120931523 TGGCACTAAGGGCTGGGTCATGG - Intronic
960760944 3:121073534-121073556 TGGTACAAACACTAGGGTCATGG - Intronic
961381360 3:126498323-126498345 TGGGACACAGAGAGGGGACAGGG - Intronic
965079627 3:164020287-164020309 TGGTACCAAGAGTTGTGTCCTGG + Intergenic
968296479 3:197580932-197580954 AGGTACAAAGGGTTGGGGCATGG - Intergenic
971688391 4:29801428-29801450 TGGTACAAATAGAAAGGTCAGGG + Intergenic
972668924 4:41195353-41195375 TGATAGAAAGAGAGGAGTCAAGG - Intronic
972952600 4:44346684-44346706 TAGTACAAAGAGAAGTGTCATGG + Intronic
974658632 4:64858175-64858197 TGTTTCAAAGAGATGGCTCCCGG + Intergenic
975808815 4:78142493-78142515 TGATACAAAAAGATCCGTCAGGG + Intronic
976689994 4:87858753-87858775 TGGTACAAAGAGGGTAGTCAGGG + Intergenic
977421232 4:96802351-96802373 TGGTACAAAGAGTTCAGTCTAGG + Intergenic
977849227 4:101804406-101804428 CAGTACAAAGAGATGTCTCATGG + Intronic
978953866 4:114592958-114592980 TGGTACAAATACTAGGGTCATGG - Intergenic
981295093 4:143122602-143122624 TGGTACAAAGAGTGGGGAAAAGG + Intergenic
983120533 4:163878531-163878553 AAGAACAAAGAGATGAGTCAGGG - Intronic
983244478 4:165271926-165271948 TGGTACATAGATGTGGGTAAGGG + Intronic
983655102 4:170074680-170074702 TGGTCCTAGGAGAGGGGTCAGGG + Intronic
984927647 4:184820481-184820503 TGGTATAAAGAGATAATTCAAGG + Intronic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
986116099 5:4776322-4776344 TGCTTGAAAGAGATTGGTCAGGG - Intergenic
989176683 5:38534456-38534478 TGGAACAAAGTGATGTTTCAAGG + Intronic
991169302 5:63602215-63602237 TTGTAGAAAGAAATGAGTCATGG + Intergenic
993929271 5:93917924-93917946 TGGTACAGGGAAATGGGACAAGG - Intronic
994837383 5:104872704-104872726 TGGTACAAAAAAATGTCTCAGGG + Intergenic
995052236 5:107719701-107719723 TGGTGAGAAGGGATGGGTCAGGG - Intergenic
995328380 5:110918228-110918250 GGGTACAGAGAGAAGGGACAAGG + Intergenic
1000412487 5:160948185-160948207 TGGTAAAAAGTGAGAGGTCATGG + Intergenic
1004841831 6:19596115-19596137 TGGTACAAAGTGATGGTTGGTGG + Intergenic
1005120086 6:22380066-22380088 GGAGACAAAGAGATGGGGCAGGG - Intergenic
1007173859 6:39883241-39883263 TCCTACACAGAGATGGGGCAAGG + Intronic
1007251784 6:40500226-40500248 TGGGACACAGAGCTGGGTGAAGG - Intronic
1008352253 6:50505744-50505766 GGGTAAAAAGAGATTGGTTATGG + Intergenic
1009796111 6:68470317-68470339 TGGTACAAATGGAGGGGTAATGG - Intergenic
1011183396 6:84647500-84647522 TGGTACAAAGAGATGAAGGATGG - Intergenic
1015527345 6:134186156-134186178 TGATACAAAGAGATGTGTAATGG - Intronic
1017116771 6:150985087-150985109 TGGCACAAATAGAAGAGTCAGGG + Intronic
1020077860 7:5270424-5270446 TGGAACACAGAGGTTGGTCAGGG - Intergenic
1020729215 7:11859696-11859718 TGGTACAAAAACATTGGTGAGGG + Intergenic
1022871909 7:34488744-34488766 GGGAAGAAAAAGATGGGTCAGGG + Intergenic
1024274886 7:47669483-47669505 TGGAACATAGAGATGGGGGAGGG + Intergenic
1025201027 7:56961746-56961768 TGGAACACAGAGGTTGGTCAGGG + Intergenic
1025670916 7:63615186-63615208 TGGAACACAGAGGTTGGTCAGGG - Intergenic
1026056596 7:66989846-66989868 TGGTTTAAAGAGATGAGTCTGGG - Intronic
1026721500 7:72835215-72835237 TGGTTTAAAGAGATGAGTCTGGG + Intergenic
1028273522 7:88822847-88822869 TGGTACAAAGAATTGTGTAAGGG + Intronic
1031367826 7:120924932-120924954 TGGATCAAACAGAGGGGTCAGGG - Intergenic
1031917215 7:127574793-127574815 TTGTCCAGAGTGATGGGTCATGG - Intergenic
1035865753 8:3079901-3079923 TGGTGCAAAGAGCTGGGTGGAGG - Intronic
1037429090 8:18790745-18790767 TGGTCCTAAGAGAAGGATCAGGG - Intronic
1037665617 8:20967321-20967343 TGGTGCCAAGATTTGGGTCATGG - Intergenic
1037677698 8:21066041-21066063 TGGTACAAACAGAAGGGTCTGGG - Intergenic
1042411532 8:68472224-68472246 TGCTACAAAGTGAGGGCTCAAGG - Intronic
1043088532 8:75868780-75868802 TGAGACAAAGAGAAGTGTCATGG - Intergenic
1043879876 8:85530242-85530264 ATGTGGAAAGAGATGGGTCAAGG - Intergenic
1045508221 8:102793756-102793778 CTGTGGAAAGAGATGGGTCAGGG - Intergenic
1047422553 8:124719011-124719033 TGGTACAAATAGAGCGATCAAGG + Intronic
1047925590 8:129679496-129679518 TGCTGCCAAGAGAGGGGTCAAGG + Intergenic
1051032751 9:12702080-12702102 TGATTCAAAGAAATGGGACATGG + Intronic
1053143768 9:35698293-35698315 AGGGACAATGGGATGGGTCAGGG + Intronic
1055011259 9:71568669-71568691 TGGTTCAAACAGTTGGGTCTGGG - Intergenic
1059012544 9:110477692-110477714 TGGGATAAAGAGAAGAGTCAAGG - Intronic
1061383702 9:130276023-130276045 TGCTAGAAAGAGATGGCCCAGGG + Intergenic
1061508421 9:131045856-131045878 GGGTATAAAGAGAAGAGTCAGGG - Intronic
1061555850 9:131368400-131368422 TGGTATAAAGAGATGGGGCTGGG + Intergenic
1187670263 X:21659103-21659125 TGCTGCAAAGGGATGGGTCGGGG - Intergenic
1190190426 X:48272462-48272484 CGTTTCAAAGAGATGGCTCAAGG + Intronic
1192016569 X:67337915-67337937 TGGTACAAATAATAGGGTCAGGG + Intergenic
1193164330 X:78264081-78264103 TGGTGAAGAGGGATGGGTCAGGG + Intergenic
1193220504 X:78920301-78920323 TGATGCATAGAGCTGGGTCATGG + Intergenic
1198523290 X:137474165-137474187 TGGTACAAAGAGAGCGATCAAGG + Intergenic
1198562983 X:137871422-137871444 GGGAACAAAGGGATGGGCCAGGG - Intergenic
1200183560 X:154166924-154166946 TGTTACAAATAGGTGGGGCACGG + Intergenic
1200189214 X:154204052-154204074 TGTTACAAATAGGTGGGGCACGG + Intergenic
1200194969 X:154241861-154241883 TGTTACAAATAGGTGGGGCACGG + Intergenic
1200200619 X:154278982-154279004 TGTTACAAATAGGTGGGGCACGG + Intronic
1200354848 X:155537724-155537746 TGGCACAGAGAGAGGGGACAAGG - Intronic
1201378038 Y:13343143-13343165 TGGTACAAACACTAGGGTCATGG + Intronic
1201509600 Y:14744351-14744373 TGGTATAAGGACATGGGTCATGG - Intronic
1201896552 Y:18998335-18998357 TGGTACAAACACTAGGGTCATGG + Intergenic