ID: 1138474955

View in Genome Browser
Species Human (GRCh38)
Location 16:57265124-57265146
Sequence CGCCGCAAGCAGGCCAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 190}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138474944_1138474955 26 Left 1138474944 16:57265075-57265097 CCCAACACACAGCACCCTGCCAG 0: 1
1: 0
2: 3
3: 37
4: 349
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138474948_1138474955 7 Left 1138474948 16:57265094-57265116 CCAGCCTCTGCTGCCCGTCAGCA 0: 1
1: 0
2: 3
3: 42
4: 327
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138474950_1138474955 -6 Left 1138474950 16:57265107-57265129 CCCGTCAGCACTCTCACCGCCGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138474941_1138474955 29 Left 1138474941 16:57265072-57265094 CCCCCCAACACACAGCACCCTGC 0: 1
1: 0
2: 6
3: 42
4: 442
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138474947_1138474955 11 Left 1138474947 16:57265090-57265112 CCTGCCAGCCTCTGCTGCCCGTC 0: 1
1: 0
2: 5
3: 36
4: 414
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138474946_1138474955 12 Left 1138474946 16:57265089-57265111 CCCTGCCAGCCTCTGCTGCCCGT 0: 1
1: 0
2: 6
3: 35
4: 477
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138474951_1138474955 -7 Left 1138474951 16:57265108-57265130 CCGTCAGCACTCTCACCGCCGCA 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138474942_1138474955 28 Left 1138474942 16:57265073-57265095 CCCCCAACACACAGCACCCTGCC 0: 1
1: 0
2: 5
3: 63
4: 632
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138474945_1138474955 25 Left 1138474945 16:57265076-57265098 CCAACACACAGCACCCTGCCAGC 0: 1
1: 0
2: 2
3: 36
4: 370
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138474949_1138474955 3 Left 1138474949 16:57265098-57265120 CCTCTGCTGCCCGTCAGCACTCT 0: 1
1: 1
2: 1
3: 24
4: 232
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138474943_1138474955 27 Left 1138474943 16:57265074-57265096 CCCCAACACACAGCACCCTGCCA 0: 1
1: 1
2: 4
3: 45
4: 459
Right 1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138474955 Original CRISPR CGCCGCAAGCAGGCCAGGTG AGG Intronic
900483828 1:2912147-2912169 CTCCGGGAGCAGGCCAGGTAAGG - Intergenic
901026325 1:6280530-6280552 CTCCTCATGCAGGGCAGGTGGGG - Intronic
901431975 1:9221925-9221947 TGGAGCAAGCAGGCCAGGTGAGG - Intergenic
901776711 1:11565242-11565264 GGCCTCAAGGAGGCCAGGTGGGG - Intergenic
904507284 1:30968348-30968370 GGCAGCAGGCATGCCAGGTGCGG - Exonic
905245779 1:36612280-36612302 CGCCCCGAGCCAGCCAGGTGTGG - Intergenic
905653770 1:39672854-39672876 CACCCCAAGCTGGGCAGGTGGGG - Intergenic
906654324 1:47536882-47536904 CGCCCCACGCAGCCCAGCTGAGG - Intergenic
906771722 1:48491111-48491133 AACGGCAAGCTGGCCAGGTGTGG + Intergenic
907554744 1:55334261-55334283 CCCCTCAAGCAGGCCACTTGTGG + Intergenic
907834232 1:58093865-58093887 AGGGGCAAGCAGGCCAGGAGAGG - Intronic
911688872 1:100808714-100808736 AGCAGCAAATAGGCCAGGTGTGG + Intergenic
915949602 1:160179987-160180009 GGGAGCAAGCAGCCCAGGTGGGG + Intronic
916660642 1:166920278-166920300 CGCCCCAAGCAGGGCTGGGGAGG + Intronic
918070014 1:181127885-181127907 AGCCACAGGCAGGCCAGGCGCGG - Intergenic
921825909 1:219671752-219671774 GGCAGAAAGCAGGCCGGGTGTGG - Intergenic
921946002 1:220886618-220886640 GCCCGCACCCAGGCCAGGTGGGG - Intergenic
922289505 1:224198801-224198823 GTCCAAAAGCAGGCCAGGTGTGG + Intergenic
922613519 1:226946771-226946793 TGCCACACACAGGCCAGGTGTGG - Intronic
923522323 1:234744999-234745021 TGCCACATGCAGGCCAGGCGTGG - Intergenic
1065752763 10:28902815-28902837 TACCGCGTGCAGGCCAGGTGAGG + Intergenic
1069500294 10:68946898-68946920 CTTGGCAATCAGGCCAGGTGCGG + Intergenic
1069820352 10:71223760-71223782 AGCCACAAGAAGGCAAGGTGGGG - Intronic
1071549841 10:86558188-86558210 CGTGGCATCCAGGCCAGGTGTGG - Intergenic
1073392360 10:103189958-103189980 TGCGGCAAACCGGCCAGGTGCGG - Intronic
1075066028 10:119289447-119289469 AGCCACAGGCAGGTCAGGTGCGG - Intronic
1076724328 10:132406400-132406422 GGCCCCAAGCAAGCCAGCTGAGG - Intronic
1076761844 10:132609930-132609952 AGCGGCAGACAGGCCAGGTGCGG - Intronic
1076804574 10:132849060-132849082 CGCCCCATGCAGGCCAGGCCGGG - Intronic
1076823790 10:132957183-132957205 CGCCCCAAGGAGGGCAGCTGAGG - Intergenic
1080522949 11:33083413-33083435 AGACACAAGTAGGCCAGGTGTGG - Intronic
1080651457 11:34225911-34225933 AGCCGCTATCAAGCCAGGTGCGG + Intronic
1081970420 11:47194492-47194514 CGAAGAAAGCAGGCCAGGTGCGG + Intergenic
1083553708 11:63609575-63609597 TGCCGCACGCAGGCTGGGTGAGG + Intronic
1083669548 11:64292339-64292361 CGCCGCACCCAGGCGAGGAGGGG - Intronic
1084329620 11:68422918-68422940 CAACGGAAGGAGGCCAGGTGAGG - Intronic
1084381082 11:68813238-68813260 TGACCAAAGCAGGCCAGGTGCGG + Intronic
1085275335 11:75294931-75294953 CAACACAAACAGGCCAGGTGTGG + Intronic
1087177597 11:95109707-95109729 AGCAGGTAGCAGGCCAGGTGTGG - Intronic
1090058207 11:123441345-123441367 CTCAGCATGCAGGCCGGGTGTGG + Intergenic
1092905964 12:13101133-13101155 CGGCGCCAGCAGGCCGGCTGGGG + Intronic
1094208879 12:27869699-27869721 AGCCCCAAGCAGGACAGGAGAGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1100194345 12:92227348-92227370 TGCCTTAAGTAGGCCAGGTGCGG + Intergenic
1101007538 12:100415718-100415740 AGTGGCAAGAAGGCCAGGTGTGG - Intronic
1104984583 12:132589483-132589505 CTTAGCCAGCAGGCCAGGTGCGG - Intergenic
1106007886 13:25788072-25788094 CCCCGCACCCAGGCCAGCTGTGG + Intronic
1109192363 13:59340934-59340956 AGCTGCAAGTAGGCCAGGCGTGG + Intergenic
1111607923 13:90564318-90564340 CTCCGCAGCCAGACCAGGTGTGG - Intergenic
1112012229 13:95301716-95301738 CGCGGCAAGGAGGCCGGGTCCGG + Intergenic
1112658954 13:101485512-101485534 GGCCGTAATTAGGCCAGGTGCGG + Intronic
1113496799 13:110737149-110737171 AGCAGAAATCAGGCCAGGTGTGG - Intergenic
1113753706 13:112793829-112793851 GGCCAGAGGCAGGCCAGGTGAGG + Intronic
1115156142 14:30341295-30341317 CGCAGAACGCAGGCCATGTGGGG - Intergenic
1117249086 14:53917390-53917412 CGGATCAAGCAGGCCAGCTGAGG - Intergenic
1118216116 14:63809930-63809952 CAAGGCAAGAAGGCCAGGTGTGG + Intergenic
1119104332 14:71909895-71909917 AACAGCAAGCAGACCAGGTGCGG + Intergenic
1119778991 14:77265812-77265834 CCCAGCTAGCTGGCCAGGTGGGG - Exonic
1119903831 14:78283797-78283819 AGCCGAAGACAGGCCAGGTGAGG - Intronic
1120993362 14:90397563-90397585 CGCTGCAGGCAGCCCGGGTGCGG - Intronic
1122626707 14:103088701-103088723 GGCTGAAAGCAGGCCAGGCGCGG + Intergenic
1122774392 14:104110798-104110820 GGCCAGGAGCAGGCCAGGTGGGG - Intronic
1125505696 15:40266345-40266367 AGCCACAGGCAGGCCAGGTGGGG + Exonic
1126142193 15:45447844-45447866 CTCCTCAAACTGGCCAGGTGTGG - Intronic
1127370546 15:58334843-58334865 CACCACAAGCAGCCCAGGGGAGG - Intronic
1128722147 15:69957907-69957929 ATCCTCAAGGAGGCCAGGTGTGG + Intergenic
1129543929 15:76374934-76374956 AGCAGAAAGCAAGCCAGGTGTGG + Intronic
1129672644 15:77615833-77615855 GGCTGCCAGCAGGCCAGGAGGGG + Exonic
1132576873 16:668341-668363 CGCCCCGCGCAGCCCAGGTGGGG + Exonic
1132601871 16:776410-776432 GGCCAAAAGCAGGCCAGGTGTGG + Intronic
1133016373 16:2943643-2943665 CCCCACAAGCAGGCCAGGCGCGG + Intronic
1133096084 16:3446899-3446921 TGCAGTGAGCAGGCCAGGTGCGG - Intronic
1133314084 16:4871285-4871307 GGCTGGATGCAGGCCAGGTGAGG + Exonic
1133500022 16:6357105-6357127 ATCCGCAAGCAGGGCAGGAGGGG - Intronic
1137549553 16:49427921-49427943 CACCAAAAGCAGGCTAGGTGGGG - Intergenic
1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG + Intronic
1140089044 16:71821880-71821902 CACCCCAAACAGGCCAGGCGCGG - Intergenic
1141586363 16:85036103-85036125 CACTCTAAGCAGGCCAGGTGTGG - Intronic
1141867562 16:86761179-86761201 CACCGAAAGCAGGCTTGGTGTGG - Intergenic
1142332929 16:89467139-89467161 AGCTGCAATCAGGCCAGGAGCGG + Intronic
1143448946 17:7024288-7024310 CGCTTCATCCAGGCCAGGTGAGG + Exonic
1146937878 17:36823914-36823936 CGCCTCAAGCAGTTCAGGTGGGG - Intergenic
1151453396 17:74212700-74212722 TGCCGAACGCAGGCCAGGAGGGG - Intergenic
1151744720 17:76005731-76005753 CCCTGCAGGCAGGGCAGGTGAGG - Exonic
1152439178 17:80295046-80295068 GGCCACTAGCAGGTCAGGTGTGG - Intronic
1152968005 18:134336-134358 CCCCACAATCAGGCCGGGTGCGG + Intergenic
1155740465 18:29282560-29282582 ACCCACAGGCAGGCCAGGTGTGG + Intergenic
1157162301 18:45325032-45325054 CGCAGCAAGCCAGCCAGATGAGG + Intronic
1157502754 18:48202690-48202712 CGCCGCACGCAGGCCATGGGAGG + Intronic
1159925184 18:74262857-74262879 CAATGCAACCAGGCCAGGTGTGG + Intronic
1160218799 18:76957385-76957407 CACCGCAAGCACCACAGGTGGGG - Intronic
1160908974 19:1466158-1466180 CGCCGCGAGGACCCCAGGTGTGG + Exonic
1160947199 19:1649135-1649157 CGGAGCAGGCAGGCCCGGTGGGG - Intronic
1161314361 19:3611048-3611070 CCCCGTGAGCAGGCCAGGTGGGG + Exonic
1161339262 19:3731848-3731870 TGCTGTAAGCAGTCCAGGTGCGG - Intronic
1161503149 19:4628671-4628693 AACCCCAAGGAGGCCAGGTGCGG - Intergenic
1162939044 19:13997157-13997179 CGGCCCAAGCAGCCCAGGGGAGG + Intronic
1163675205 19:18652297-18652319 GGGCTCCAGCAGGCCAGGTGCGG + Intronic
1164632399 19:29770132-29770154 CGCAGAGAGCAGGCCATGTGAGG + Intergenic
1165357760 19:35314166-35314188 TGCAGGAAGCCGGCCAGGTGTGG - Intergenic
1165430238 19:35767946-35767968 CGCCGCCAGCCTTCCAGGTGGGG + Exonic
1165690577 19:37859961-37859983 ATCCAAAAGCAGGCCAGGTGTGG + Intergenic
1165772126 19:38386023-38386045 CGGCGCCAGCAGGGCAGGTGCGG + Exonic
1166354010 19:42216688-42216710 CGCCGCTTGCGCGCCAGGTGCGG + Exonic
1167301892 19:48682688-48682710 CACCCGAAGCTGGCCAGGTGTGG + Intergenic
925887058 2:8402120-8402142 TGTGGCAAGCTGGCCAGGTGAGG + Intergenic
926090031 2:10043633-10043655 CGCCGCCCGCAGCCCACGTGCGG + Exonic
927988360 2:27429095-27429117 CCCCGCGAGCAGGCCAGGCCAGG - Intronic
928955517 2:36863011-36863033 AGCTAAAAGCAGGCCAGGTGCGG - Intronic
933228851 2:79782525-79782547 GAAGGCAAGCAGGCCAGGTGCGG - Intronic
934936660 2:98470476-98470498 CCCTGCAAGGAGGCCTGGTGGGG + Intronic
935006021 2:99077850-99077872 GGCCGCGTGCAGGCCGGGTGCGG - Intronic
937446680 2:121964367-121964389 AGCTAAAAGCAGGCCAGGTGCGG + Intergenic
937484968 2:122306209-122306231 AGACGCATGCTGGCCAGGTGCGG + Intergenic
945430260 2:209755441-209755463 TGCTGCAAGCAGGCACGGTGAGG - Intergenic
946033549 2:216724096-216724118 AACAGCAAGGAGGCCAGGTGGGG + Intergenic
946323210 2:218966153-218966175 AAACGTAAGCAGGCCAGGTGTGG + Intergenic
946642829 2:221802560-221802582 TGCTGCAACTAGGCCAGGTGCGG + Intergenic
947418493 2:229921723-229921745 CGCCGGGAGCAGGCCAAGCGGGG + Intronic
947512957 2:230775522-230775544 TGCCTCAAAGAGGCCAGGTGTGG - Intronic
948935129 2:241158953-241158975 CCCACCAAGCAGGCCAGTTGGGG - Intronic
1168913169 20:1466477-1466499 CGCCGCAAGCGGGCGAGGCAGGG + Intronic
1169122716 20:3107003-3107025 CGGGGGAAGCAGGGCAGGTGTGG + Intergenic
1171450236 20:25230650-25230672 AGCAACAGGCAGGCCAGGTGCGG + Intergenic
1171806135 20:29681976-29681998 TGCAGCAATCTGGCCAGGTGCGG + Intergenic
1171837926 20:30174445-30174467 TGCAGCAATCTGGCCAGGTGTGG - Intergenic
1176027273 20:62992459-62992481 GGATGCATGCAGGCCAGGTGTGG - Intergenic
1178507146 21:33171445-33171467 CCCCGCCAGCAGGACAGGTAGGG - Intergenic
1178942159 21:36915115-36915137 CCCCACAAGAAGCCCAGGTGGGG - Intronic
1180083520 21:45497407-45497429 CCCCGTCAGCAGGCCATGTGGGG - Intronic
1181638960 22:24187018-24187040 CACCGCAAGCATGGCAGGGGTGG + Intronic
1184398381 22:44259151-44259173 GGCCAGAAGCGGGCCAGGTGCGG + Intronic
1185317659 22:50185934-50185956 CGCCGCATGGAGGCCGGCTGAGG + Exonic
952380323 3:32799466-32799488 ACCCACAAACAGGCCAGGTGTGG + Intergenic
953044191 3:39280802-39280824 CGCCCCAAGCTGGCCAGGCCAGG - Intronic
957630787 3:82714404-82714426 AGCAGTAAGAAGGCCAGGTGCGG + Intergenic
958056352 3:88417389-88417411 CTCCTCAACCAGGCCAGGAGAGG - Intergenic
959694988 3:109239736-109239758 TGCCAAAAGCAGGCCGGGTGTGG + Intergenic
960687095 3:120306057-120306079 AGCCCAAAGCAGGCCAGGCGCGG + Intergenic
960994509 3:123332130-123332152 AGCCGCCTGCAGGCCAGCTGGGG + Intronic
963602980 3:147393292-147393314 GGCCCCTAGGAGGCCAGGTGAGG + Intronic
966857179 3:184202857-184202879 CACCGCAACCAGCCCAAGTGTGG + Intronic
967286466 3:187875592-187875614 CTCTGCAAGCAGGCCCGGCGCGG - Intergenic
968089678 3:195892424-195892446 CGCCGCAGTCTGGCCAGGAGAGG + Intronic
968237367 3:197041762-197041784 GGAAGCAAGCAAGCCAGGTGCGG - Intergenic
971325326 4:25638730-25638752 AGGGGGAAGCAGGCCAGGTGCGG + Intergenic
971673067 4:29589538-29589560 AGGATCAAGCAGGCCAGGTGTGG + Intergenic
972541183 4:40040773-40040795 TATCTCAAGCAGGCCAGGTGTGG - Intergenic
977602177 4:98945033-98945055 AGCCAAAAGTAGGCCAGGTGTGG - Intergenic
978851481 4:113342408-113342430 TTACCCAAGCAGGCCAGGTGTGG + Intronic
979946928 4:126843813-126843835 CATCACAGGCAGGCCAGGTGTGG - Intergenic
981232662 4:142375864-142375886 CGCAGCAAAAAGTCCAGGTGTGG - Intronic
981610738 4:146591023-146591045 AGCCTCAAGAAGGCCAGATGAGG - Intergenic
982445526 4:155486630-155486652 GGCAGCAATGAGGCCAGGTGCGG + Intergenic
982458769 4:155641706-155641728 CTATGCAAGAAGGCCAGGTGTGG + Intergenic
985613868 5:907741-907763 CGCCCCGGGCAGGTCAGGTGTGG + Intronic
985740708 5:1614709-1614731 TCCCGCATGCAGGCCAAGTGGGG - Intergenic
986350886 5:6878440-6878462 CGCCCCACGCTGGCCAGCTGGGG - Intergenic
988960446 5:36365523-36365545 AACCTAAAGCAGGCCAGGTGTGG - Intergenic
989323120 5:40159930-40159952 ACCCCAAAGCAGGCCAGGTGCGG - Intergenic
990863144 5:60350651-60350673 CGCAGGATGCAGGACAGGTGTGG + Intronic
992889675 5:81192540-81192562 CGACGCAGGCAGGCCAGCGGTGG + Intronic
994869437 5:105327607-105327629 GGCCACAAGCAGGCCAGGCGCGG + Intergenic
997291438 5:132738560-132738582 TGAAGCAAGGAGGCCAGGTGGGG - Intergenic
1000832873 5:166126076-166126098 TGCAAGAAGCAGGCCAGGTGAGG + Intergenic
1006847429 6:37072313-37072335 TGCCATCAGCAGGCCAGGTGCGG + Intergenic
1007538913 6:42622692-42622714 AGCCAAAAACAGGCCAGGTGCGG - Intronic
1010578470 6:77564171-77564193 GGCCGGGAGCTGGCCAGGTGCGG + Intergenic
1013054444 6:106569737-106569759 AGCCCCATGCAGGCCATGTGTGG - Exonic
1017615300 6:156240851-156240873 CACAGCAAGAAGGCCAGGTGCGG + Intergenic
1019293297 7:260911-260933 TGGTGCAAACAGGCCAGGTGGGG + Intergenic
1019406513 7:886927-886949 CCCCGCCAGCTGGCAAGGTGGGG + Intronic
1023870672 7:44261485-44261507 CTCCCCATGCAGGCCTGGTGGGG + Intronic
1025201324 7:56963672-56963694 AGCCTAATGCAGGCCAGGTGTGG + Intergenic
1025670620 7:63613261-63613283 AGCCTAATGCAGGCCAGGTGTGG - Intergenic
1026870305 7:73847025-73847047 AGCCCAAGGCAGGCCAGGTGTGG + Intergenic
1026925226 7:74187508-74187530 CGCCGCCAGCGCCCCAGGTGAGG - Intronic
1032247233 7:130223337-130223359 GGCCTCAGGGAGGCCAGGTGCGG + Intergenic
1032816738 7:135483532-135483554 AACTCCAAGCAGGCCAGGTGCGG + Intronic
1033171803 7:139091207-139091229 CCCCTCCAGCAGGCCAGGCGCGG + Intronic
1034626792 7:152499609-152499631 TACCACAATCAGGCCAGGTGTGG - Intergenic
1034959646 7:155357232-155357254 CACCGTGAGCAGGACAGGTGGGG - Exonic
1035287414 7:157815173-157815195 AGCAGCACCCAGGCCAGGTGAGG - Intronic
1035382157 7:158447023-158447045 CGCAGCTAGGATGCCAGGTGGGG + Intronic
1035830523 8:2689987-2690009 CTTAGCAAGCAGGCCAGGCGCGG + Intergenic
1037536117 8:19826370-19826392 TGCAGCAAGGAGGCCAGGCGCGG - Intronic
1037877380 8:22554659-22554681 GGACGCTAGCAGGTCAGGTGGGG + Intronic
1039865444 8:41497098-41497120 TGCAGTAAGCTGGCCAGGTGCGG - Intronic
1041108873 8:54467204-54467226 CGCCGTGAGCAGGCCGGATGCGG + Intergenic
1045029592 8:98122117-98122139 CGGTGTAACCAGGCCAGGTGCGG - Intronic
1046948549 8:119998374-119998396 CCCCACAATGAGGCCAGGTGCGG - Intronic
1047733910 8:127749357-127749379 CTCCATAAGTAGGCCAGGTGTGG + Intergenic
1049216277 8:141409812-141409834 CAGCGCAAGCAGGGCAGGAGGGG - Intronic
1056382546 9:86068156-86068178 AGAGGCAAGCAGGCCATGTGAGG + Intronic
1057531397 9:95849799-95849821 AGCCACCAACAGGCCAGGTGCGG + Intergenic
1058726805 9:107812412-107812434 AGCATCAAGGAGGCCAGGTGTGG - Intergenic
1060151003 9:121288216-121288238 GACAGAAAGCAGGCCAGGTGAGG - Intronic
1061609799 9:131739206-131739228 CTCTGCAAGGAGGGCAGGTGGGG - Intronic
1185477426 X:423798-423820 CATCACAAGCAGGCCACGTGCGG + Intergenic
1186179729 X:6961107-6961129 CACCAAAAGTAGGCCAGGTGTGG + Intergenic
1187467377 X:19539529-19539551 AGCCTCAAGCAGTCCAGCTGTGG + Intronic
1202351916 Y:24002014-24002036 TGCCGCAGGCCAGCCAGGTGGGG + Intergenic
1202518863 Y:25668105-25668127 TGCCGCAGGCCAGCCAGGTGGGG - Intergenic