ID: 1138477270

View in Genome Browser
Species Human (GRCh38)
Location 16:57279113-57279135
Sequence TCATTCCCACATATAGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138477263_1138477270 15 Left 1138477263 16:57279075-57279097 CCCTCGGATCCTATAACCCTGTG 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 301
1138477264_1138477270 14 Left 1138477264 16:57279076-57279098 CCTCGGATCCTATAACCCTGTGA 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 301
1138477265_1138477270 6 Left 1138477265 16:57279084-57279106 CCTATAACCCTGTGAATCCAAAC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 301
1138477267_1138477270 -2 Left 1138477267 16:57279092-57279114 CCTGTGAATCCAAACTGTCCTTC 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 301
1138477266_1138477270 -1 Left 1138477266 16:57279091-57279113 CCCTGTGAATCCAAACTGTCCTT 0: 1
1: 1
2: 3
3: 15
4: 199
Right 1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138477270 Original CRISPR TCATTCCCACATATAGTGCT AGG Intronic
900070381 1:767140-767162 TCATTAGCAAATTTAGTGCTAGG + Intergenic
903424529 1:23244078-23244100 TCATTCCCACATATCATGAAGGG + Intergenic
904099173 1:28008200-28008222 TCTTTTCAACAAATAGTGCTGGG + Intronic
904217842 1:28937931-28937953 TCCTTTCAACATATAATGCTGGG - Intronic
907370022 1:53995395-53995417 TCTTTTCAACAAATAGTGCTGGG + Intergenic
907431224 1:54413053-54413075 TCTTTCCCACATGTGATGCTTGG - Intronic
908169630 1:61491915-61491937 TCATTCCCACACATATTCCTCGG + Intergenic
908462695 1:64361016-64361038 TCTTTCCAACAAATAGTGTTGGG + Intergenic
909232538 1:73108294-73108316 TAAATCCCACATATAGTGAATGG - Intergenic
910549992 1:88464769-88464791 TTTTTCCCACATAAAGTGCGGGG - Intergenic
910925592 1:92395063-92395085 TCTTTTCAACAAATAGTGCTAGG + Exonic
911081107 1:93932130-93932152 TCTTTTCAACAAATAGTGCTGGG + Intergenic
911600148 1:99839579-99839601 TCTTTTCAACAAATAGTGCTGGG + Intergenic
911648292 1:100358856-100358878 GCATTCCCACAAATATTTCTAGG - Intronic
911793365 1:102046670-102046692 TCATTAACATATATAGTCCTCGG - Intergenic
913695063 1:121316905-121316927 TCATTCCTCCCTATAGTTCTGGG + Intronic
914142498 1:144963153-144963175 TCATTCCTCCCTATAGTTCTGGG - Intronic
915573649 1:156760567-156760589 TCACTCTCACATATATTCCTTGG + Intronic
916324548 1:163542343-163542365 TAATTCCCACATATTGTGGGAGG - Intergenic
916650347 1:166829353-166829375 TAATTCCCACATATTGTGAGAGG + Intergenic
917118973 1:171629238-171629260 TAATTCCCACATATTGTGGGAGG - Intergenic
917426126 1:174916153-174916175 TCTTTTCAACAAATAGTGCTGGG - Intronic
918633367 1:186746606-186746628 TAATTCCCACATGTAGTGGAAGG + Intergenic
919184600 1:194129517-194129539 TCATTCCCTCAAAAAGTACTAGG - Intergenic
919816165 1:201441323-201441345 TCATTTCAACAAATGGTGCTGGG + Intergenic
920192869 1:204205392-204205414 TCTTTCCAACAGATAGTGCTGGG - Intronic
920482396 1:206335290-206335312 TCATTCCTCCCTATAGTTCTGGG + Intronic
920772105 1:208897814-208897836 TCCTTTCAACAAATAGTGCTGGG - Intergenic
922017036 1:221658962-221658984 TCTTTTCAACATATGGTGCTGGG - Intergenic
922266086 1:223985195-223985217 TCATTAGCAAATTTAGTGCTAGG + Intergenic
1063064629 10:2595477-2595499 TAATTCCCACATATTGTGAGAGG + Intergenic
1064903252 10:20316687-20316709 TCATTTCCACATATACTACCTGG + Intergenic
1065454632 10:25894154-25894176 TCATTACCAGAGATTGTGCTAGG + Intergenic
1066728429 10:38414774-38414796 TCATTAGCAAATTTAGTGCTAGG - Intergenic
1067444700 10:46334221-46334243 TATTTCACACATATAGTGCCTGG + Intergenic
1072041325 10:91609478-91609500 TCATTCCCATATATAGAATTGGG + Intergenic
1072586497 10:96787395-96787417 TCACCCCCACACAAAGTGCTGGG + Intergenic
1072595124 10:96864469-96864491 CCATATCCCCATATAGTGCTTGG - Intronic
1073642368 10:105265801-105265823 TCATTCACATATATATGGCTGGG + Intergenic
1073885119 10:108029794-108029816 TCTTTTCAACAAATAGTGCTGGG + Intergenic
1073888107 10:108064977-108064999 TCAGTCACTCATAAAGTGCTTGG - Intergenic
1076007928 10:126962958-126962980 TCTTTTCCACAAATGGTGCTGGG - Intronic
1076974502 11:161892-161914 TCATTAGCAAATTTAGTGCTAGG + Intergenic
1077270454 11:1676088-1676110 TCTTTTCCACAAATAGTGCTGGG - Intergenic
1077521276 11:3036559-3036581 ACATTCCCACCCATAGTGCATGG - Intronic
1077625270 11:3765901-3765923 TCTTTTCAACATATGGTGCTGGG - Intronic
1081050006 11:38327132-38327154 TAATTCCCACATATTGTGGGAGG + Intergenic
1081565870 11:44260965-44260987 TCACTCACACACATAGAGCTAGG - Exonic
1083098376 11:60277243-60277265 TCATTCCCACATGTTGTGGGAGG - Intergenic
1085196635 11:74676665-74676687 ACCTTCCCACATTTGGTGCTGGG + Intergenic
1085364821 11:75930073-75930095 TCATTTGCAAATATTGTGCTAGG + Intronic
1086554967 11:88098556-88098578 TCATTCCTACAATGAGTGCTGGG + Intergenic
1086926846 11:92649986-92650008 TCATACCCAAAGAGAGTGCTGGG + Intronic
1087516710 11:99173153-99173175 TAATTCCCACATATTGTGGGAGG - Intronic
1088778230 11:113107725-113107747 TAATTCCCACATATTGTGGGAGG - Intronic
1089405331 11:118192803-118192825 TAATTCCCACATATTGTGGGAGG + Intergenic
1089865089 11:121624603-121624625 TCATTCCTACATATTGTTCTGGG + Intronic
1090488285 11:127134693-127134715 TAATTCCCACATGTAGTGGGAGG - Intergenic
1090701721 11:129301878-129301900 TCAATCCCACATATATAGATAGG + Intergenic
1091579885 12:1778479-1778501 TCTTTCCAACAAATGGTGCTGGG + Intronic
1093918210 12:24829647-24829669 TCATGCCCACACATTGTGTTGGG + Intronic
1095781103 12:46060737-46060759 TCATTCCAACAAATGATGCTTGG + Intergenic
1095879617 12:47119144-47119166 TCTTTTCAACAAATAGTGCTGGG + Intronic
1097480900 12:60125129-60125151 TAATTCCCACATGTAGTGGGAGG + Intergenic
1097600113 12:61681206-61681228 TAATTCCCACATGTAGTGGGAGG + Intergenic
1097735977 12:63180984-63181006 TCATCCCCACATAAAGAGCATGG + Intergenic
1099466883 12:82999761-82999783 TAATTCCCACATATTGTGGAAGG - Intronic
1100424224 12:94468168-94468190 TCTTTTCAACAAATAGTGCTGGG + Intergenic
1101274609 12:103185625-103185647 TAATTCCCACATATTGTGGGAGG + Intergenic
1105903803 13:24783125-24783147 TCTTTTCAACAAATAGTGCTGGG - Intronic
1108009639 13:45992287-45992309 TCATTGCCAAAAATAATGCTTGG - Intronic
1109012412 13:56969340-56969362 TAATTCCCACATATTGTGGGAGG - Intergenic
1109614013 13:64807690-64807712 TCATTCCCACATGTTGTGGGAGG + Intergenic
1109958560 13:69601991-69602013 TAATTCCCACATATTGTGGGAGG - Intergenic
1110559906 13:76899543-76899565 CCATTCCCACATATTGTGGGAGG - Intergenic
1111067134 13:83107956-83107978 GAATTCCCACATATTGTGCGAGG + Intergenic
1111155052 13:84310568-84310590 TCATTCCCACATGTTGTGGGAGG + Intergenic
1111527763 13:89493613-89493635 TAATTCCCACATATTGTGGAAGG - Intergenic
1111756037 13:92397216-92397238 TCATTCCCACATGTTGTGGGAGG + Intronic
1112789759 13:102989984-102990006 TCTTTTCAACAAATAGTGCTGGG - Intergenic
1114691766 14:24589294-24589316 CCTTTTCCACAAATAGTGCTGGG - Intergenic
1115132543 14:30071686-30071708 TAATTCCCACATGTTGTGGTAGG + Intronic
1115146191 14:30228786-30228808 TCATTCACACATATAGAAATGGG + Intergenic
1115269226 14:31533318-31533340 TCTTTCCAACAAATGGTGCTGGG - Intronic
1117515585 14:56497904-56497926 TCTTTCCAACAAATAATGCTAGG - Intronic
1119054175 14:71402195-71402217 TCATTCATTCATATAGTGCTGGG + Intronic
1120486020 14:85113865-85113887 TAATTCCCACATATGGTGGGAGG - Intergenic
1120806524 14:88757233-88757255 TCATTTCAACAAATAGTACTGGG + Intronic
1120951111 14:90042788-90042810 TAATTCCCACATATCGTGGGAGG - Intronic
1122480831 14:102046264-102046286 TCAACCCCACGTGTAGTGCTTGG - Intronic
1122977278 14:105176007-105176029 TCATACCAACATCTAGTCCTGGG + Intronic
1124245131 15:28062787-28062809 TCTTTCCAACAAATTGTGCTGGG - Intronic
1124810361 15:32930924-32930946 TCTCTCCAACAGATAGTGCTAGG - Intronic
1125178329 15:36851789-36851811 TCATTTCCACCAAAAGTGCTGGG - Intergenic
1126943399 15:53791001-53791023 TCATTCCCACATCTGGTGCCTGG + Intergenic
1127242286 15:57129664-57129686 TCATTCTCAAAAATAGTGCAAGG - Intronic
1132996303 16:2825280-2825302 TCATTCCCACATGTTGTGGGAGG - Intronic
1135054076 16:19216044-19216066 GAATTCCCACATATAGTGGGAGG - Intronic
1135654843 16:24238934-24238956 TAATTCCCACATATTGTGGGAGG + Intergenic
1138256225 16:55564603-55564625 TCTTTTCAACAAATAGTGCTGGG + Intronic
1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG + Intronic
1138548325 16:57733045-57733067 TAATTCCCACATATTGTGGGAGG - Intergenic
1139164203 16:64546873-64546895 TAATTCCCACATATTGTGGGAGG - Intergenic
1140766410 16:78163500-78163522 TCATTTCCAAACATAGTGGTTGG - Intronic
1141038124 16:80646177-80646199 TAATTCCCACATATTGTGGGAGG - Intronic
1142461752 17:99705-99727 TCATTAGCAAATTTAGTGCTAGG + Intergenic
1142526558 17:546112-546134 TCGTTTCAACAAATAGTGCTGGG + Intronic
1146027914 17:29338743-29338765 TCTTTCCAACAAATGGTGCTAGG + Intergenic
1146227805 17:31082342-31082364 TCCTTCCAACAAATACTGCTGGG - Intergenic
1148571522 17:48673470-48673492 TTTTCCCCACAAATAGTGCTGGG + Intergenic
1149715478 17:58785201-58785223 TTTTTCCAACATATGGTGCTAGG - Intronic
1149739066 17:59026175-59026197 TCTTTTCAACAAATAGTGCTGGG + Intronic
1150545033 17:66147741-66147763 TCATTTCCACAAATGGTGTTGGG - Intronic
1151105950 17:71617632-71617654 TAATTCCCACATATTGTGGGAGG + Intergenic
1155781496 18:29842583-29842605 TCTTTTCCACAAATAATGCTGGG - Intergenic
1155843290 18:30672766-30672788 TGATTCCCACATATTGTGAGAGG - Intergenic
1156256741 18:35405233-35405255 TCTTTTCAACAAATAGTGCTGGG + Intergenic
1156895914 18:42245249-42245271 TAATTCCCACATATTGTGAGAGG - Intergenic
1157320924 18:46633382-46633404 TCTTTTCAACAAATAGTGCTGGG + Intronic
1157713984 18:49869872-49869894 TCAGTCCCACATCTACTGCTGGG + Intronic
1158727515 18:59986997-59987019 ACATTCCCACATATACAGCATGG - Intergenic
1160387092 18:78503369-78503391 TCCCTCCCACATACAGGGCTCGG + Intergenic
1160651453 19:232069-232091 TCATTAGCAAATTTAGTGCTAGG + Intergenic
1167670318 19:50848839-50848861 GCATTCCCACATATATTTCCTGG + Intergenic
1167725445 19:51209510-51209532 TCATTCCCACTTCTTGTGCCAGG - Intergenic
1167864788 19:52315764-52315786 TCCTTCCTACACATAGGGCTTGG + Intronic
925638143 2:5961758-5961780 TAATTCCCACATGTTGTGGTAGG + Intergenic
925884032 2:8378979-8379001 TCTTTCCCATACAAAGTGCTAGG + Intergenic
927211974 2:20644651-20644673 TCATTCCCAAATCAAGGGCTTGG - Intronic
927802524 2:26114500-26114522 TCTTTCCAACAAATGGTGCTGGG + Intronic
928769314 2:34687347-34687369 TCATTCCTACAGATAATGGTTGG - Intergenic
929023852 2:37579937-37579959 TAATTCCCACATATTGTGGGAGG + Intergenic
929815498 2:45227941-45227963 TCATTCCCACATGTGGTGGGAGG + Intergenic
930317988 2:49820713-49820735 TAATTCCCACATATTGTGGGAGG - Intergenic
930394595 2:50805058-50805080 TAATTCCCACAGTAAGTGCTGGG - Intronic
931289356 2:60858713-60858735 TACTTCCCACAGATACTGCTGGG + Intergenic
931373672 2:61688231-61688253 TCTTTTCAACAAATAGTGCTGGG + Intergenic
932010238 2:67970144-67970166 TCATTCTTACATATAGTACAAGG - Intergenic
933140600 2:78788227-78788249 TAATTCCCACATATTGTGGGAGG - Intergenic
933462681 2:82609092-82609114 TAATTCCCACATATTGTGGGAGG + Intergenic
934581447 2:95444120-95444142 TCATTCCCCCATATGGAGGTTGG + Intergenic
934598003 2:95632594-95632616 TCATTCCCCCATATGGAGGTTGG - Intergenic
934885261 2:98018970-98018992 TCTTTTCAACAGATAGTGCTGGG - Intergenic
934892307 2:98081205-98081227 TAATTCCCACATATTGTGGGAGG - Intergenic
935121747 2:100189101-100189123 ACATTCCCACCCATAGTGCAGGG + Intergenic
936731329 2:115384867-115384889 TAATTCCCACATATTGTGGGAGG + Intronic
936969756 2:118165558-118165580 TAATTCCCACATTTTGTGGTGGG + Intergenic
937755776 2:125536573-125536595 TCATTTCAACAAATAGTACTGGG - Intergenic
939707482 2:145473061-145473083 TCTTTCCAATAAATAGTGCTGGG - Intergenic
940316564 2:152333869-152333891 TCAATTCCACAAATAGTTCTTGG + Intergenic
940595495 2:155786961-155786983 TCATTCACACATATGCTGGTTGG - Intergenic
941837189 2:170037053-170037075 TCATTCTCACCTGTAGTGTTAGG + Intronic
942209775 2:173658774-173658796 TCATTCCCTCTTCTATTGCTTGG + Intergenic
943833025 2:192486058-192486080 TAATTCCCACATATTGTGGGAGG + Intergenic
945657285 2:212640689-212640711 TCATTCCTACTTAAAGTACTTGG + Intergenic
945786762 2:214249113-214249135 TCAGTCCCACATAGTGTGTTTGG - Intronic
945823418 2:214691893-214691915 TCTTTTCAACAAATAGTGCTGGG + Intergenic
946524518 2:220504214-220504236 TAATTCCCACATATTGTGGGAGG - Intergenic
947602469 2:231462887-231462909 TCACCCCCACATGTAGAGCTGGG - Intronic
1169796432 20:9467938-9467960 GCATTCCCACATGCAGTGGTTGG + Intronic
1172272914 20:33664421-33664443 TCACTCCTACACATTGTGCTTGG + Intronic
1173143372 20:40504016-40504038 TGATTCCCACATATATTTCTTGG + Intergenic
1173225225 20:41158568-41158590 CATGTCCCACATATAGTGCTGGG + Intronic
1175570503 20:60015856-60015878 TCTTTCCAACAAATGGTGCTGGG - Intronic
1176367342 21:6041245-6041267 TCTTTCCATCAAATAGTGCTGGG - Intergenic
1177626573 21:23669794-23669816 TCTTTCCCACCTTTAGTACTAGG + Intergenic
1177749706 21:25264702-25264724 TAGTTCCCACATATTGTGGTAGG + Intergenic
1179756176 21:43497301-43497323 TCCTTCCATCAAATAGTGCTGGG + Intergenic
1181507108 22:23366728-23366750 TAATTCCCACATATTGTGGGAGG + Intergenic
1182210736 22:28675147-28675169 TCTTTTCAATATATAGTGCTGGG + Intronic
1182230346 22:28833083-28833105 TCATTTTTACATATAGTGCTTGG - Intergenic
951276369 3:20691372-20691394 ACATTCCCACACACAGTTCTTGG - Intergenic
952000202 3:28776422-28776444 TTATTCCCAACTATATTGCTTGG - Intergenic
952566676 3:34667701-34667723 TCTTTTCAACAAATAGTGCTGGG - Intergenic
953821794 3:46213234-46213256 TCACTCCCACATCTAGGGTTGGG + Intronic
954517061 3:51187617-51187639 TAATTCCCACATATTGTGGGAGG + Intronic
954729483 3:52646665-52646687 TCTTTTCTATATATAGTGCTGGG + Intronic
956213648 3:66826580-66826602 TAATTCCCACATATTGTGGGAGG + Intergenic
956246153 3:67185892-67185914 TAATTCCCACATATTGTGGGAGG - Intergenic
957090560 3:75725808-75725830 TAATTCCCACATATTGTGGGAGG - Intronic
957287700 3:78238506-78238528 TTATTCCCAGACATTGTGCTTGG + Intergenic
959609457 3:108277641-108277663 TAATTCCCACATATTGTGGGAGG - Intergenic
960197067 3:114781706-114781728 TAATTCCCACATATTGTGGGAGG + Intronic
961418412 3:126779681-126779703 TCTTTTCAACAAATAGTGCTGGG - Intronic
963294455 3:143530256-143530278 TGATTCCCACATATTGTGGGGGG + Intronic
963594855 3:147313450-147313472 TCCTTTGCACCTATAGTGCTGGG - Intergenic
964473220 3:157076118-157076140 TCATTCTCACATCCATTGCTGGG - Intergenic
966412196 3:179655311-179655333 TCATTTCCACAAATAGTTATTGG + Intronic
967571104 3:191029270-191029292 TCATTCCCACAAATATTCCCTGG + Intergenic
967771222 3:193335407-193335429 TCATTGCCTAAAATAGTGCTGGG - Intronic
968366379 3:198187896-198187918 TCATTAGCAAATTTAGTGCTAGG - Intergenic
970329704 4:14966887-14966909 TAATTCCCACATGTTGTGCGAGG - Intergenic
970548899 4:17159146-17159168 TCTTTTCAACAAATAGTGCTGGG - Intergenic
970640575 4:18061167-18061189 TCATTTCAACAAATGGTGCTGGG - Intergenic
971898198 4:32623605-32623627 TAATTCCCACACATTGTGGTAGG - Intergenic
973710392 4:53624267-53624289 TAATTCCCACATGTAGTGGAAGG + Intronic
974386135 4:61202729-61202751 ACACACCCACCTATAGTGCTGGG - Intronic
974394910 4:61322258-61322280 TGATTCCCACATATTGTGGCAGG - Intronic
974969705 4:68808421-68808443 TAATTCCCACATATTGTGGGAGG + Intergenic
975981716 4:80168821-80168843 TAATCCCCACAAATTGTGCTGGG - Intergenic
978034332 4:103975433-103975455 TAATTCCCACATATTGTGGGAGG + Intergenic
978034612 4:103977353-103977375 TAATTCCCACATATTGTGGGAGG + Intergenic
978286633 4:107085457-107085479 TCATTCCCAAATCTGGTTCTAGG - Intronic
979059345 4:116036890-116036912 TCTTTTCAACAAATAGTGCTGGG + Intergenic
979063408 4:116097236-116097258 TAATTCCCACATATTGTGGGAGG + Intergenic
979912833 4:126391430-126391452 TCTTTTCAACAAATAGTGCTGGG - Intergenic
980431243 4:132699259-132699281 GTCTTCCAACATATAGTGCTGGG + Intergenic
980734416 4:136867016-136867038 TCAATACCACATATAGTTCAGGG - Intergenic
981145698 4:141321613-141321635 TAATTCCCACATGTTGTGCGAGG - Intergenic
983292657 4:165825848-165825870 TAATTCCCACATATTGTGGGAGG + Intergenic
983302914 4:165949787-165949809 TAATTCCCACATATTGTGGGAGG - Intronic
984387784 4:179085788-179085810 TCTTTCCAACAAATGGTGCTAGG - Intergenic
984603279 4:181753832-181753854 TCATACCCACACATTGTACTAGG + Intergenic
984997623 4:185450980-185451002 TAATTCCCACATATTGTGGGAGG + Intronic
987012456 5:13781499-13781521 TAATTCCCACATGTTGTGGTGGG + Intronic
987098083 5:14567579-14567601 TAATTCCCACATATTGTGGGAGG - Intergenic
987313504 5:16702479-16702501 TCCTTCCCACTTCTAATGCTTGG - Intronic
988028087 5:25726550-25726572 TAATTCCCACATATTGTGGGAGG - Intergenic
988098351 5:26646168-26646190 TAATTCCCACATATTGTGGGAGG + Intergenic
988291334 5:29291740-29291762 TTGTTCTCACATATGGTGCTGGG + Intergenic
988332521 5:29860647-29860669 TAATTCCCACATATTGTGAGAGG - Intergenic
989012492 5:36888932-36888954 TCATTCCAAAATATGGTACTTGG - Intronic
990183578 5:53189540-53189562 TCCTTTCCATATTTAGTGCTTGG + Intergenic
990965999 5:61448714-61448736 TCATACCCCCATATATTTCTTGG - Intronic
992083135 5:73253971-73253993 TAATTCCCACATATTGTGGGAGG + Intergenic
995007598 5:107219082-107219104 TCAGTGCCATATATTGTGCTTGG + Intergenic
995649329 5:114350687-114350709 TCTTTTCCACAAAAAGTGCTAGG - Intergenic
995759225 5:115545418-115545440 TGATTCCCACATATTGTGGGAGG - Intergenic
997620823 5:135292392-135292414 TCTTTTCCACAAATGGTGCTGGG - Intronic
997796029 5:136812220-136812242 TCTTTTCAACAAATAGTGCTGGG + Intergenic
998110610 5:139499580-139499602 TCTTTCCGACAAATGGTGCTGGG - Intergenic
998917536 5:147031804-147031826 TCTTTTCCACAAATGGTGCTGGG + Intronic
999918730 5:156293551-156293573 TCATTTCAACAAATGGTGCTGGG - Intronic
1000234992 5:159349471-159349493 TCTTTCCAACAAATGGTGCTGGG - Intergenic
1000565044 5:162836085-162836107 TAATTCCCACATGTTGTGCGAGG - Intergenic
1001273864 5:170336231-170336253 TCATCCCCACATGTAGGGCTGGG - Intergenic
1001673028 5:173490406-173490428 TAATTCCCACATTTTGTGCGAGG - Intergenic
1002725604 5:181293119-181293141 TCATTAGCAAATTTAGTGCTAGG - Intergenic
1003598043 6:7492548-7492570 TCTTTTCAACAAATAGTGCTGGG - Intergenic
1006283178 6:33072668-33072690 TCATTCCAAAATCTAGTGATGGG - Intronic
1007856531 6:44863965-44863987 TAATTCCCACATATTGTGGGAGG - Intronic
1008637169 6:53422447-53422469 TCTTTTGAACATATAGTGCTGGG - Intergenic
1009490389 6:64283936-64283958 TCATTCCCACCTATTGTGGGAGG - Intronic
1009793408 6:68433864-68433886 TAATTCCCACATATTGTGGGAGG - Intergenic
1010581786 6:77608028-77608050 TCATTTCCATATTCAGTGCTAGG + Intergenic
1011439030 6:87368560-87368582 TAATTCCCACATATTGTGGGAGG - Intronic
1011715544 6:90101469-90101491 TCTTTTCAACATATAGTGCCAGG - Intronic
1012483900 6:99699014-99699036 TCTTTTCAACAAATAGTGCTGGG - Intergenic
1013419685 6:109955630-109955652 TCATTCCCACATGTTGTGGGAGG - Intergenic
1013515382 6:110880592-110880614 TCGCTTCCACAAATAGTGCTGGG - Intronic
1013783794 6:113757029-113757051 TAATTCCCACATATTGTGGGAGG + Intergenic
1016079556 6:139839155-139839177 TCCTTCACACATACAGAGCTGGG + Intergenic
1016592719 6:145764731-145764753 TAATTCCCACATATTGTGGGAGG + Intergenic
1017679885 6:156853036-156853058 TCATTTGCACATACAGTGATCGG + Intronic
1018813405 6:167314123-167314145 TCATTAACACATTTAGTGCTGGG + Intronic
1020585188 7:10056299-10056321 TAATTCCCACATATTGTGAGAGG + Intergenic
1021381630 7:19974329-19974351 TCTTTTCCACAAACAGTGCTAGG - Intergenic
1022212191 7:28222367-28222389 ACATTTCCACATATTGAGCTGGG - Intergenic
1023647521 7:42333877-42333899 TCCTTTCAACAAATAGTGCTGGG + Intergenic
1023650404 7:42363612-42363634 TAATTCCCACATATTGTGGGAGG - Intergenic
1025986824 7:66460727-66460749 TCTTTTCAACAAATAGTGCTGGG + Intergenic
1026020017 7:66698999-66699021 TCAGTCCCACATGCAGCGCTGGG + Intronic
1027191482 7:75998652-75998674 TCATTTCAACAAATGGTGCTAGG + Intronic
1028668505 7:93373591-93373613 TAATTCCCACATATTGTGGGAGG - Intergenic
1028957882 7:96713938-96713960 TAATTCCCACATATTGTGGGAGG + Intergenic
1029340289 7:99937397-99937419 TCATTTCAACAAATTGTGCTGGG - Intergenic
1031097720 7:117441310-117441332 TAATTCCCACATATTGTGGAAGG - Intergenic
1031301479 7:120066959-120066981 TCATTCCCACATATTGTGGAAGG + Intergenic
1031408187 7:121410606-121410628 TCTCTCCCACATATAATGCAAGG + Intergenic
1031459051 7:122022977-122022999 TCCTTCCAACAGATGGTGCTAGG + Intronic
1031703737 7:124957877-124957899 TCATTCACAAATATATTGTTTGG + Intergenic
1031766096 7:125779555-125779577 TCATTTCCCCAAAGAGTGCTGGG - Intergenic
1034321725 7:150190578-150190600 TCTTTCCAACAAATGGTGCTGGG - Intergenic
1034545872 7:151788880-151788902 TCTTTTCAACAAATAGTGCTGGG - Intronic
1034712849 7:153210194-153210216 TTTTTTCAACATATAGTGCTTGG - Intergenic
1034771022 7:153776699-153776721 TCTTTCCAACAAATGGTGCTGGG + Intergenic
1035069152 7:156128148-156128170 TCATTCCTACAATGAGTGCTGGG - Intergenic
1037331328 8:17746639-17746661 TAATTCCCACATATTGTGGGAGG - Intronic
1039123980 8:34180108-34180130 TCTTTTCAACAAATAGTGCTAGG + Intergenic
1040100539 8:43498082-43498104 TCTTTTCCACAAATGGTGCTGGG - Intergenic
1043686969 8:83099119-83099141 TTATTCTCACATATACTGGTAGG - Intergenic
1044503202 8:92986777-92986799 TCATTCCCAAATACAGAGATTGG + Intronic
1044956831 8:97489986-97490008 TAATTCCCACATATTGTGGGAGG + Intergenic
1045824469 8:106380575-106380597 ACATTCCCACCTACAGTGTTTGG + Intronic
1048562072 8:135550457-135550479 TCTTTTCAACATATGGTGCTAGG - Intronic
1048907573 8:139103261-139103283 TAATTCCCACATGTTGTGCGAGG - Intergenic
1049329961 8:142045289-142045311 TCATTCCCACAGAAAGTGATGGG + Intergenic
1050894900 9:10873827-10873849 TCATTCCCACATATTGAGAGAGG - Intergenic
1051417745 9:16860444-16860466 TCTTTTCAACAAATAGTGCTGGG + Intronic
1051526033 9:18045620-18045642 AAATTCTCACATATAGTGATAGG + Intergenic
1053588880 9:39490251-39490273 TAATTCCCACATATTGTGGGAGG + Intergenic
1054577423 9:66875044-66875066 TAATTCCCACATATTGTGGGAGG - Intronic
1055911263 9:81354973-81354995 TCCTTCCAACAAATGGTGCTGGG + Intergenic
1056475918 9:86950767-86950789 TAATTCCCACATATTGTGGGAGG - Intergenic
1057589214 9:96357291-96357313 TCTTTTCAACAAATAGTGCTGGG + Intronic
1058735199 9:107887688-107887710 TAATTCCCACATGTAGTGGGAGG - Intergenic
1061879136 9:133559958-133559980 TCATCCCCACAAATACTGCCTGG + Intronic
1061948608 9:133922606-133922628 TCGTTCCAACACATGGTGCTGGG + Intronic
1185921990 X:4103655-4103677 ACATCCCCAGATATAATGCTTGG - Intergenic
1187902315 X:24036333-24036355 TCTTTTCAACAAATAGTGCTGGG + Intergenic
1188083896 X:25880129-25880151 GAATTCCCACATATTGTGGTAGG + Intergenic
1190731733 X:53231118-53231140 ACATTGCCCCATATAGTGCCTGG - Intergenic
1191126664 X:56963024-56963046 TAATTCCCATATATTGTGGTAGG - Intergenic
1191218720 X:57962428-57962450 TCATTTCAACAAATAGTGTTGGG - Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1194332276 X:92598586-92598608 ACATTCCCACAAATAGTGCATGG - Intronic
1195224297 X:102776678-102776700 TAATTCCCACATGTTGTGCGAGG - Intergenic
1195736975 X:108021787-108021809 TCATTTCAACAAATATTGCTGGG - Intergenic
1195863967 X:109409627-109409649 TGATTCCCACATATTGTGAGAGG + Intronic
1197002942 X:121460608-121460630 TAATTCCCACATATTGTGAGAGG + Intergenic
1197249324 X:124198416-124198438 TAATTCCCACATATTGTGGGAGG - Intronic
1197546229 X:127827660-127827682 TCATTTCAACAAATAGTACTGGG - Intergenic
1198889206 X:141374096-141374118 TAATTCCCACATATTGTGGGAGG + Intergenic
1199014289 X:142794474-142794496 TCTTTCCAACAAATAGTGCTGGG - Intergenic
1199153962 X:144524581-144524603 TAATTCCCACATGTTGTGCGAGG - Intergenic
1199229640 X:145422449-145422471 TCCTTTCCACATATAATGCAGGG + Intergenic
1199743085 X:150754054-150754076 TCTTTCCAACAAATGGTGCTGGG - Intronic
1200575499 Y:4884299-4884321 TAATTCCCACATATCGTGGGAGG + Intergenic
1200640981 Y:5717637-5717659 ACATTCCCACAAATAGTGCATGG - Intronic