ID: 1138480247

View in Genome Browser
Species Human (GRCh38)
Location 16:57298045-57298067
Sequence CACACGTCACAGACCGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138480242_1138480247 1 Left 1138480242 16:57298021-57298043 CCTCCTGCTATGCCGCCGGTTCC No data
Right 1138480247 16:57298045-57298067 CACACGTCACAGACCGCTATAGG No data
1138480240_1138480247 22 Left 1138480240 16:57298000-57298022 CCTTAGCTTGTGTGTGGCTCACC No data
Right 1138480247 16:57298045-57298067 CACACGTCACAGACCGCTATAGG No data
1138480243_1138480247 -2 Left 1138480243 16:57298024-57298046 CCTGCTATGCCGCCGGTTCCTCA No data
Right 1138480247 16:57298045-57298067 CACACGTCACAGACCGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138480247 Original CRISPR CACACGTCACAGACCGCTAT AGG Intergenic