ID: 1138481432

View in Genome Browser
Species Human (GRCh38)
Location 16:57305815-57305837
Sequence CCTGATAGGCAGGGAGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138481417_1138481432 26 Left 1138481417 16:57305766-57305788 CCACCCTAGAAGGAGAACCCCAG No data
Right 1138481432 16:57305815-57305837 CCTGATAGGCAGGGAGTAGAGGG No data
1138481420_1138481432 22 Left 1138481420 16:57305770-57305792 CCTAGAAGGAGAACCCCAGGAAT No data
Right 1138481432 16:57305815-57305837 CCTGATAGGCAGGGAGTAGAGGG No data
1138481424_1138481432 7 Left 1138481424 16:57305785-57305807 CCAGGAATGGCTGAGACGACAGC No data
Right 1138481432 16:57305815-57305837 CCTGATAGGCAGGGAGTAGAGGG No data
1138481419_1138481432 23 Left 1138481419 16:57305769-57305791 CCCTAGAAGGAGAACCCCAGGAA No data
Right 1138481432 16:57305815-57305837 CCTGATAGGCAGGGAGTAGAGGG No data
1138481422_1138481432 9 Left 1138481422 16:57305783-57305805 CCCCAGGAATGGCTGAGACGACA No data
Right 1138481432 16:57305815-57305837 CCTGATAGGCAGGGAGTAGAGGG No data
1138481423_1138481432 8 Left 1138481423 16:57305784-57305806 CCCAGGAATGGCTGAGACGACAG No data
Right 1138481432 16:57305815-57305837 CCTGATAGGCAGGGAGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138481432 Original CRISPR CCTGATAGGCAGGGAGTAGA GGG Intergenic
No off target data available for this crispr