ID: 1138488041

View in Genome Browser
Species Human (GRCh38)
Location 16:57359238-57359260
Sequence GGGGTTCTCCCTTGGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138488041 Original CRISPR GGGGTTCTCCCTTGGAAAGC TGG Intronic
900231784 1:1562709-1562731 GGGGCTGTGCCTTGGAAAGGAGG - Intronic
901701504 1:11047005-11047027 GGCATACTCCCCTGGAAAGCCGG + Exonic
901839693 1:11946115-11946137 CAGTTTCCCCCTTGGAAAGCAGG - Intronic
902571333 1:17348820-17348842 TGGGGTCTTCCTGGGAAAGCAGG - Intronic
902999700 1:20256329-20256351 GGGCTTGGCCTTTGGAAAGCTGG - Intergenic
908767782 1:67569877-67569899 TGTGTTTTGCCTTGGAAAGCTGG - Intergenic
911164483 1:94712758-94712780 GGGTTTCTCTCTTGGACAGGTGG - Intergenic
916417749 1:164608777-164608799 GGGGCTTTCCCATGGAATGCAGG + Intronic
918099430 1:181360899-181360921 AGGGTTCTACCTGGGAAAGCGGG + Intergenic
921803901 1:219432654-219432676 GAGGGTCTCCTTGGGAAAGCAGG + Intergenic
922412719 1:225391654-225391676 GGGTCTCTGGCTTGGAAAGCTGG + Intronic
1064993042 10:21273297-21273319 AGATTTCTCCCTTGGAGAGCTGG + Intergenic
1067153843 10:43758307-43758329 AGGGCTCTCACTTGGAAAGAAGG - Intergenic
1067178403 10:43966742-43966764 GAGGTTCACCCTTTGGAAGCTGG + Intergenic
1067182511 10:43999657-43999679 GTGGTTCTGCCTTGGAGACCTGG + Intergenic
1067392932 10:45882124-45882146 GGATTGTTCCCTTGGAAAGCAGG + Intergenic
1067861254 10:49851245-49851267 GGATTGTTCCCTTGGAAAGCAGG + Intronic
1071299291 10:84244616-84244638 GGGGTTCTTCCTCTGACAGCAGG + Intergenic
1071580141 10:86761792-86761814 GGATTTCTAGCTTGGAAAGCAGG + Intronic
1078241554 11:9535168-9535190 GGGCTTCACTGTTGGAAAGCTGG + Intergenic
1078357685 11:10644656-10644678 AGGGTTCTCACTGGGGAAGCTGG + Intronic
1079132018 11:17752333-17752355 GGCGATCTCCCTGGGAAACCAGG + Intronic
1079399230 11:20092418-20092440 GGGGTTCTCGCTTAGAGATCAGG - Intronic
1082587166 11:54955201-54955223 GGGCTTCACCCTTGGGATGCAGG - Intergenic
1083692210 11:64416444-64416466 GGGGTTCTCCATTGGAACCATGG - Intergenic
1084442053 11:69180154-69180176 GTGTCTCTCCCTTGGATAGCAGG + Intergenic
1084502652 11:69544086-69544108 AGGGTTCTCCCATGGAAATAGGG - Intergenic
1087349093 11:97008420-97008442 GGAGCTCTCCAATGGAAAGCTGG - Intergenic
1088851122 11:113704320-113704342 GAGATTATTCCTTGGAAAGCAGG - Intronic
1090076317 11:123582045-123582067 TGGTTTCTCCGTTGTAAAGCAGG + Intronic
1090394836 11:126412074-126412096 GGGTTTCTAGCTTGGACAGCCGG + Intronic
1091266722 11:134276903-134276925 GGGGATCTGCCGAGGAAAGCTGG - Intronic
1093650254 12:21635063-21635085 GGGGTTCTTCCTTTTAAAACGGG + Intergenic
1096417466 12:51425992-51426014 TGGTTTCTGCCTTGGAAAGAGGG + Intronic
1096836646 12:54355529-54355551 GGCTTTCTCACTTGGAATGCAGG + Intergenic
1097222987 12:57461397-57461419 GGGGTTAACCCTTGGGAAGCCGG + Intronic
1102241858 12:111329466-111329488 GGGGTTCTCCCTGGGGGAGTGGG + Intronic
1102522168 12:113485208-113485230 GTGGTTCTCCCTGGGAGAGTAGG + Intergenic
1108484503 13:50910256-50910278 GGGATTCTCTCTGGGACAGCTGG + Intronic
1109580279 13:64322235-64322257 GAGATTTTCCCTTTGAAAGCTGG - Intergenic
1112280723 13:98060702-98060724 GGCGTTCTCCCCTGGACACCTGG + Intergenic
1112847573 13:103663113-103663135 GGCTTTCTCCCTTGGAAAAGAGG - Intergenic
1112975806 13:105315488-105315510 GGGATACTCCCTTGGGAACCCGG + Intergenic
1113293339 13:108929693-108929715 CGGGTCCTCCCATGGAAGGCAGG - Intronic
1113460580 13:110479422-110479444 GGGGTGCTCTCTAGGAAAGGGGG + Intronic
1115041532 14:28936068-28936090 AGGGTTTTCCCTTCCAAAGCCGG - Intergenic
1118321198 14:64754333-64754355 TGGGTTCTCCCTTTGTAAGGTGG - Intronic
1119524418 14:75310906-75310928 GGGCTTCCCCCTCAGAAAGCTGG - Intergenic
1120731591 14:88008917-88008939 GGGGTCCTCACTTGGAAACTAGG - Intronic
1121278722 14:92685371-92685393 GGTGTTCTCCCTGGGCAAGCAGG + Intronic
1121533874 14:94677799-94677821 CGGTTTCTACCTTGGAAGGCTGG - Intergenic
1121614992 14:95307738-95307760 GGAGCTCTCTCTTGGAGAGCTGG - Intronic
1121780975 14:96622278-96622300 AGGGTGCTCCCTGGGAAGGCTGG + Intergenic
1123562391 15:21508638-21508660 GAGGTTCTCCATTGGCAGGCAGG - Intergenic
1123598636 15:21945925-21945947 GAGGTTCTCCATTGGCAGGCAGG - Intergenic
1124084181 15:26531511-26531533 GGTTTGCTCCCCTGGAAAGCAGG + Intergenic
1124891783 15:33740443-33740465 GGGGTCCTCACTGGAAAAGCTGG + Intronic
1125969089 15:43897545-43897567 GGGGTTCTTCTTTAGAGAGCTGG + Intronic
1127268833 15:57382794-57382816 GGGGTCCTCACTTGGAAAATGGG - Intronic
1130399602 15:83537143-83537165 AGGGTTTTACCTTGGAATGCAGG + Intronic
1132025129 15:98398879-98398901 GGTGGTCTCTCTTGAAAAGCTGG + Intergenic
1134062529 16:11207795-11207817 GGGCTCCTCCCATGGAAGGCGGG - Intergenic
1134871787 16:17658463-17658485 GGTGTTCTCCCTTTGAATGAAGG + Intergenic
1137374598 16:47941840-47941862 TGAATTCTCCCTTTGAAAGCTGG - Intergenic
1138488041 16:57359238-57359260 GGGGTTCTCCCTTGGAAAGCTGG + Intronic
1139394361 16:66628397-66628419 GGACCTCTGCCTTGGAAAGCCGG - Intronic
1139410248 16:66752793-66752815 GAGTTCCTCCCTTGGAAATCTGG + Intergenic
1139439162 16:66956048-66956070 GGACCTCTGCCTTGGAAAGCCGG - Intergenic
1140033638 16:71357441-71357463 AGGGTTGTCCCTTGGAGAGAGGG - Intergenic
1140188055 16:72791999-72792021 GGGGTTCTCCTTTGGTGAACTGG + Intronic
1144074462 17:11704349-11704371 GCCGGTCTCCCTTGGAGAGCTGG - Exonic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144961760 17:19048319-19048341 AGGGTTCTCCCTGGGAAAGAAGG + Intergenic
1144973401 17:19126203-19126225 AGGGTTCTCCCTGGGAAAGAAGG - Intergenic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1148020220 17:44548370-44548392 GGGGTGCTCCCTTGGGAGGGAGG - Intergenic
1148656610 17:49288607-49288629 GGGTTTCTCCACTAGAAAGCAGG + Intergenic
1152959245 18:68552-68574 GGTGTTTTCCCTGGGAACGCAGG - Intronic
1153314066 18:3704729-3704751 GGGCTGCTCAGTTGGAAAGCTGG - Intronic
1156239756 18:35241274-35241296 TGCGTTTTCCTTTGGAAAGCAGG - Intronic
1156519960 18:37713789-37713811 GGGGCTCTCCCTTGGAGTGGAGG + Intergenic
1161274757 19:3409618-3409640 GGAGTTGTCCCTTGCAAAGGGGG + Intronic
1161995723 19:7710206-7710228 GGGCTTCTTCCTAGGAAGGCTGG - Intergenic
1162708780 19:12576183-12576205 GGGGTGCTCCCAGGGAAATCAGG + Intronic
1164305514 19:24002092-24002114 GTGGTGCTCCCTTGGCAAACTGG + Intergenic
1164600915 19:29562712-29562734 GGGCTTCTCACCTGGAAAGTGGG - Intronic
927510409 2:23640872-23640894 GTGGCTCTCCCTTGGACAGTGGG + Intronic
928201352 2:29249626-29249648 AGAGTTCTCCCTTGGAAACATGG + Intronic
930811345 2:55545188-55545210 GATGTTTTCCCTTGGAAAGAGGG + Intronic
931208783 2:60172738-60172760 AGTGTTCTCACCTGGAAAGCAGG - Intergenic
938576378 2:132608341-132608363 GGGGTTCTCCCTATGACAGCTGG - Intronic
944069733 2:195655716-195655738 GGACTTCTCCCTTTGTAAGCAGG + Intronic
948264715 2:236628152-236628174 AGGGATGTCCCTGGGAAAGCGGG + Intergenic
948317920 2:237043736-237043758 GGGGTTCTTCCTTGGACCGCTGG - Intergenic
948844143 2:240675189-240675211 GGGCTTCTCCCTGGGGATGCCGG - Intergenic
948849717 2:240699690-240699712 GGGCTTCTCCCTGGGGATGCCGG + Intergenic
1172816106 20:37687808-37687830 GGGGCTCTCTCTTAGAAAGAAGG - Intergenic
1182033759 22:27181425-27181447 GGGGTTCTCCATTTAAGAGCAGG - Intergenic
1183984529 22:41562195-41562217 GGGCCTCTCCCTGGGAAAGGGGG + Intronic
1185191065 22:49436512-49436534 GGGGTTATGCTTTGGAAAGATGG - Intronic
950493638 3:13320937-13320959 GGGCTGCTACCTTGGAGAGCTGG - Intronic
950644327 3:14368149-14368171 GGGGGTCTCCCATGGGGAGCTGG - Intergenic
952801195 3:37293630-37293652 GTGTTTCTCCCTTAGAATGCCGG - Intronic
953032117 3:39185953-39185975 GGGGTTCCCTCTGAGAAAGCTGG + Exonic
959659187 3:108846380-108846402 AGGGTTCTCCCCTGTAAAGCAGG + Intronic
961539668 3:127590948-127590970 GCGTTTCTCACTCGGAAAGCGGG + Intronic
961829975 3:129618415-129618437 CGGGTTCTGCCTTGGGCAGCTGG - Intergenic
966826096 3:183966333-183966355 GGGGGTCTACTGTGGAAAGCCGG + Intronic
972321441 4:37976978-37977000 GGGGGTCACCCCTGGAAAGTTGG + Intronic
975833826 4:78399526-78399548 GGGTTTGTGCCTTGCAAAGCAGG + Intronic
978483329 4:109220463-109220485 GTGGTTCCCCCATGGAATGCAGG + Intronic
979559896 4:122089756-122089778 GGGGTTGTCCCTGGCAAATCAGG - Intergenic
979615737 4:122740325-122740347 GGGGATCTCCCTTGTAACACTGG + Intronic
983313284 4:166093733-166093755 GGACCTCTGCCTTGGAAAGCCGG - Intronic
986185334 5:5430572-5430594 ATGGTTCTGTCTTGGAAAGCAGG - Intronic
987290039 5:16500181-16500203 GGGCTTCTCCCAGGGACAGCTGG + Intronic
997340491 5:133140948-133140970 GGGCTTCTCACTGGGAAGGCAGG + Intergenic
998630458 5:143892402-143892424 GGGATTCTCCCTAAGACAGCTGG - Intergenic
1000261788 5:159595384-159595406 GATTTTCTCCCTGGGAAAGCTGG + Intergenic
1001517288 5:172364862-172364884 GGGCTTCTCCACTGGAGAGCTGG + Intronic
1003347986 6:5288389-5288411 GTGATTCCCTCTTGGAAAGCAGG - Intronic
1014490925 6:122060802-122060824 GGTGTTATTCCTTGCAAAGCAGG + Intergenic
1017720667 6:157241052-157241074 CGGGATCCCCCTTGGAAACCTGG - Intergenic
1019411448 7:908516-908538 GGGGTTCTTCCATGGGAAGGGGG - Intronic
1021115098 7:16738557-16738579 GGTGTTCTCTCTTGGAAAAGGGG - Intergenic
1022399311 7:30021901-30021923 GGGGTTCTCACTTGAACAGCAGG + Intronic
1024596806 7:50945460-50945482 CTGGTTCTTCCTTAGAAAGCTGG + Intergenic
1027450013 7:78320687-78320709 GAAGTACTCCCTTGGAAAACTGG + Intronic
1027714549 7:81653615-81653637 GGGCTTCTCATTTGGAAAGTAGG - Intergenic
1027992782 7:85384213-85384235 GGGTTTCTACCTTTGTAAGCTGG - Intergenic
1032390435 7:131552303-131552325 TTGGTTCTCCCTAGGAAACCAGG + Intronic
1032594905 7:133229632-133229654 TGAGCTCTCCCTTGGAGAGCAGG - Intergenic
1034986084 7:155516407-155516429 GGGGTCCTCACTTGGGAAGTGGG - Intronic
1035896873 8:3412910-3412932 TGGGCTCTCCATTGGGAAGCTGG + Intronic
1036679269 8:10859071-10859093 TGGGTTCTCCCTTTGAAACACGG - Intergenic
1040582771 8:48710857-48710879 GGGGTTGTCCCAGGCAAAGCAGG - Intronic
1045035516 8:98173550-98173572 GGGGTCTTCCCTTGGAATCCAGG + Intergenic
1048008742 8:130440003-130440025 GGGGTTCTGGCTTGAACAGCTGG - Intronic
1049193655 8:141303629-141303651 GGGGTTCTGCCTTGAAATCCTGG - Intronic
1049867710 8:144949763-144949785 GGACTTCTGCCTTGGAAAGCCGG + Intronic
1050616773 9:7409376-7409398 GGTGTTCTCGCATGGAAATCTGG + Intergenic
1054418543 9:64902955-64902977 GGACTTCTGCCCTGGAAAGCCGG - Intergenic
1061819413 9:133217779-133217801 GTGGTTCTCCCAAGGGAAGCTGG - Intergenic
1061975764 9:134067514-134067536 TGGGTTCCCCCTTCGAAAGATGG + Intronic
1062241273 9:135540410-135540432 GTGGTTCTCCCAAGGGAAGCTGG + Intergenic
1186756707 X:12679114-12679136 GGTGTTCTCCATTGGAAATTGGG - Intronic
1188003199 X:25001102-25001124 GGGGGTGGCCCTGGGAAAGCAGG + Intergenic
1189156014 X:38757423-38757445 GGGATTTTCCTTTGGAAAACTGG + Intergenic
1192435628 X:71141974-71141996 GGGGTTCTCCTTGGGAAGGCAGG - Intronic
1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG + Intergenic
1196130870 X:112154744-112154766 GTGGTTCTTCATTTGAAAGCAGG - Intergenic