ID: 1138488403

View in Genome Browser
Species Human (GRCh38)
Location 16:57361483-57361505
Sequence ATGGAGAAACAGGCTTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 1, 2: 7, 3: 66, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138488397_1138488403 11 Left 1138488397 16:57361449-57361471 CCTACGAGGAAGTTCAACGATTC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG 0: 1
1: 1
2: 7
3: 66
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138488403 Original CRISPR ATGGAGAAACAGGCTTAGCA AGG Intronic
902033882 1:13442413-13442435 AGGGAAAAACAGGCATAGAAGGG + Intergenic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
903309970 1:22447509-22447531 GGGGAGAAACAGGCTTGGCTGGG + Intergenic
903974231 1:27138684-27138706 ATGGAGGAACAGGCCTGGCAAGG + Intronic
904195174 1:28780174-28780196 TAGGAGAAACAGGCCGAGCACGG - Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904562233 1:31406653-31406675 ATAGAGAAACAGGCCCAGAAAGG + Intergenic
904894413 1:33803435-33803457 ATGGAGGAACATGCTTTGCAGGG - Intronic
905133292 1:35777914-35777936 ATGGAGAGAAAGGCTGAGCCTGG - Intergenic
905221069 1:36448134-36448156 ATGGAGAAACAGGTTTATAGAGG + Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905652927 1:39668521-39668543 ATGGGGAAACAGGCCCAGAAAGG + Intronic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909763027 1:79317197-79317219 ACAAAGAAACTGGCTTAGCAAGG + Intergenic
909776161 1:79488045-79488067 AAGGATAAACAGGCCAAGCATGG - Intergenic
910039715 1:82835073-82835095 ATTGAGAAAAAGGCTGAGCGGGG + Intergenic
910262132 1:85303069-85303091 ATGAAGAAACTGGCCAAGCAGGG + Intergenic
910408807 1:86917562-86917584 ATGCAGGAACAGGCTTAGAGAGG + Intronic
910473035 1:87575962-87575984 ATGAGGAAATAGGCTTAGAATGG + Intergenic
910517485 1:88078730-88078752 ATGGAGAGACATTCTTCGCAGGG + Intergenic
912553432 1:110499151-110499173 ATGGAAACAGAGGCTCAGCAGGG + Intergenic
913074095 1:115326531-115326553 ATGTGGAAACAGGCTTTCCAAGG - Intronic
913511579 1:119567426-119567448 GTAGAGAAACAGGCAGAGCATGG - Intergenic
913515816 1:119604752-119604774 GTAGAGAAACAGGCAGAGCATGG - Intergenic
915614714 1:157028413-157028435 AGGGAAAAACAGGCGTAGAAAGG + Intronic
915614755 1:157028874-157028896 ATGGAGAAACTGGCTGGGCGTGG + Intronic
915985450 1:160459715-160459737 ATGGGAAAACAGGCTTAGAGAGG + Intergenic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918345179 1:183601565-183601587 ATGGTGAATCAGGCTGAGCACGG + Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
920677625 1:208049077-208049099 AGGAAGGAACAGGCATAGCAGGG - Intronic
920786417 1:209046451-209046473 TTGCAGAAACAGGCTGGGCACGG - Intergenic
920916725 1:210263679-210263701 GTGGAGAAAGAGCCTTGGCAGGG + Intergenic
922107348 1:222523984-222524006 GTGGAGACTGAGGCTTAGCAAGG - Intronic
924054360 1:240111184-240111206 ATGAGGAAACAGGATTACCAGGG + Intronic
924074477 1:240319051-240319073 ATGAAAATACAGGCTTAGAAGGG + Intronic
924818112 1:247460630-247460652 ATGGTGGAACAGGCTAGGCATGG + Intergenic
1063008697 10:2000688-2000710 AAGGAGTAAAAGGATTAGCAAGG + Intergenic
1063423835 10:5935983-5936005 ATAAAGACACAGGCTTAGCGAGG + Intronic
1064797069 10:19024557-19024579 ATAGCCAAACTGGCTTAGCAAGG + Intergenic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1065363672 10:24913851-24913873 GTGGAGAAACAGGATTTGTATGG + Intronic
1065538278 10:26735754-26735776 ATAAGGAAACAGTCTTAGCAAGG - Intronic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1065888302 10:30098308-30098330 GGGGAGAAACAGGGGTAGCATGG - Intronic
1065996490 10:31064156-31064178 ATGGAGATTCTGGCTTAGAAAGG + Intergenic
1066203051 10:33160301-33160323 GTGGAGAAACAGGTCAAGCACGG - Intergenic
1066556539 10:36620566-36620588 CTGTAGACACAGGCTTGGCATGG - Intergenic
1068507146 10:57915366-57915388 ATAGAGAAACAAGGATAGCAGGG + Intergenic
1069426064 10:68289633-68289655 AAGGAGAAAGAGACTTAGAAAGG + Intronic
1070317480 10:75329035-75329057 ATGGAAAGACAGGCCGAGCACGG - Intergenic
1071494294 10:86157126-86157148 AAGGAGGAACAAGCTTAGGATGG + Intronic
1072072419 10:91931958-91931980 AAGGATAAACAGGCTTGGAATGG + Intronic
1072218650 10:93309153-93309175 TTGGAGGAACTGTCTTAGCAGGG + Intronic
1073134091 10:101210277-101210299 ATGAGGAAACTGGCTTAGCGAGG + Intergenic
1073476595 10:103757659-103757681 AGGGAGTAACAAGCTTTGCAGGG - Intronic
1073698001 10:105892536-105892558 ATGCAGAAATTGGCTTGGCATGG - Intergenic
1074087916 10:110222703-110222725 ATGGGGAAACAGGAAAAGCAAGG - Intronic
1074275965 10:112002391-112002413 ATAGAGAAGCAAGCTAAGCATGG - Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074751264 10:116589592-116589614 ATGGAGAAACAGGCTAGACTTGG - Intergenic
1075060684 10:119254762-119254784 ATGGAAAAACAGGCCGGGCACGG + Intronic
1076150318 10:128157064-128157086 ATCGGAAAACAGGCTGAGCATGG - Intergenic
1076617218 10:131763329-131763351 GTGGAGAAGCAGGCTTGGTAGGG + Intergenic
1080081918 11:28230873-28230895 ATGGGGAAATAGACTTGGCATGG + Intronic
1080538719 11:33246205-33246227 ATGGAGAAACTCATTTAGCAAGG - Intergenic
1080582788 11:33657485-33657507 ATGAGGAAACAGGCTTGGAAAGG + Intronic
1081651296 11:44825805-44825827 ATGGAGAAACAAGCCCACCAGGG - Intronic
1081982581 11:47277585-47277607 ATGTAGAAAGAGGCTGGGCACGG - Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084155161 11:67309190-67309212 ATGGGGAAACAAGCCCAGCAGGG + Intronic
1084912354 11:72401037-72401059 ATGAAGAAACAGGCTGTCCATGG + Intronic
1085025757 11:73235631-73235653 ATGGAGAAACAGGCCCAGAGAGG + Exonic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1086455081 11:86953333-86953355 TTGGAGAAACAGCTTTTGCAGGG - Intronic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087948142 11:104190113-104190135 ACACAGAAACAGGCTTAGAATGG - Intergenic
1089140347 11:116279251-116279273 CTGGAAAAACAGCCTTGGCAGGG + Intergenic
1089791378 11:120947111-120947133 AGGGAGAAATAGGCTGGGCACGG + Intronic
1089854743 11:121533301-121533323 ATGAGAAAACAGGCTCAGCAAGG + Intronic
1090132289 11:124157285-124157307 ATTGAGAAACAGTATCAGCAAGG - Intergenic
1090376016 11:126290173-126290195 ATGGAGAAACGAGTTTAGCAAGG + Intronic
1090568205 11:128018959-128018981 TTGGAGAAAGAGCCTGAGCATGG - Intergenic
1091538316 12:1434811-1434833 ATGACGAAAGAGGCTCAGCATGG - Intronic
1092370185 12:7910413-7910435 ATGGATAAACAGGCTGGGCGCGG + Intergenic
1094243995 12:28265619-28265641 CTGGAAAAACAGGGTTAGTAAGG - Intronic
1096479025 12:51925806-51925828 ATGCAGAAACAGACTTACAAGGG + Intergenic
1096584159 12:52608667-52608689 ATGAACAAACAGGAGTAGCAAGG + Intronic
1097485832 12:60198546-60198568 ATGGCGAGACAGGCTTGCCAAGG + Intergenic
1097703469 12:62844229-62844251 AGGCAGAAACAGTTTTAGCAGGG + Intronic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1099399315 12:82182356-82182378 CTTGGGCAACAGGCTTAGCAGGG + Intergenic
1099541983 12:83922789-83922811 AGGGAGAAACAGGAATAGTAAGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100826398 12:98478759-98478781 ATGATGAAACAGGCTTACGAAGG + Intergenic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101241114 12:102841100-102841122 ATGAGGAAACAGGCTTGGGAAGG + Intronic
1101775033 12:107785924-107785946 ATTCAGAAACAGGCCAAGCATGG - Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1102477324 12:113196934-113196956 ATGCAGAAACGGGCTTGGGAAGG + Intronic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1102766883 12:115441065-115441087 ATGAAGAAATAGGCTTAGAGGGG + Intergenic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1105494128 13:20915611-20915633 ATGGACAAAGGGGCTGAGCACGG + Intergenic
1105983183 13:25539859-25539881 ATCGAGGCACAGGCTTGGCAAGG - Intronic
1106150307 13:27094211-27094233 GTGGAGAAACTGGCCCAGCACGG + Intronic
1106200454 13:27532418-27532440 ATGAAGAAACAGAATTAGCGAGG - Intergenic
1107571099 13:41658962-41658984 AAGGAGACACAGGCCTAACAGGG - Intronic
1107864637 13:44691871-44691893 ATGCAGATCCAGGCTTTGCAAGG - Intergenic
1108000784 13:45904105-45904127 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1108393899 13:49974432-49974454 ATGGAGAAACAGGCCGGGTACGG - Intergenic
1110568275 13:76977920-76977942 ATGCAGATACAGGCTGGGCATGG + Intergenic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1115737583 14:36350797-36350819 ATGGAGAAACATCCATAACATGG + Intergenic
1117505675 14:56400553-56400575 CTGGAAAAACAAGCTCAGCAAGG + Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119859913 14:77928748-77928770 ATGCAAAAACAGGCTGGGCACGG - Intronic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121813007 14:96907939-96907961 ATGGAGAAAAAGGCACATCATGG + Intronic
1121942654 14:98087547-98087569 ATTGAGAAACAGGCTTTACAAGG - Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1124384332 15:29194250-29194272 AAGGAGCAACAGCCTTGGCAGGG - Intronic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126451027 15:48809943-48809965 ATGGGGGAACAGGCTTGGGAGGG - Intronic
1126772207 15:52069706-52069728 ATGAAGAAACAGGCTTGGACTGG - Intergenic
1126931469 15:53656972-53656994 AAGGAAAAACAGGCCTCGCATGG + Intronic
1127267844 15:57376089-57376111 AGGGGGAAAAAGGCTAAGCAGGG + Intronic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128907211 15:71477792-71477814 AAGGAGAAGCAGGTTCAGCATGG - Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129600232 15:76994499-76994521 AGAGAGAAACAGGATTATCAAGG - Intronic
1132001979 15:98189842-98189864 ATAGGGAAACAGACTTAGCAAGG + Intergenic
1132135344 15:99332196-99332218 AGAGATAGACAGGCTTAGCAAGG + Intronic
1133013132 16:2925721-2925743 ATGGAGGAACAGGCTGGGCCGGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1134371402 16:13629261-13629283 AAGGAGAAAAAGGCTTAGTCTGG + Intergenic
1135781961 16:25311490-25311512 AAGGAGAGACAGGCCTAGCCTGG - Intergenic
1135830960 16:25772869-25772891 ATGGAGAAACGGCCATGGCAGGG + Intronic
1136011514 16:27366542-27366564 ATGGAGAAACAGTTTTAGAGAGG + Intergenic
1136063452 16:27742614-27742636 AGGAGGAAACAGGCTCAGCAGGG - Intronic
1136363315 16:29795978-29796000 ATGGAGGTACAGGCTGGGCAGGG + Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136620471 16:31425051-31425073 AGAGAGAAACAGGCTTAGAGAGG - Intronic
1138005739 16:53335377-53335399 ATGAATAAACAAGCTTAGCAAGG + Intergenic
1138022534 16:53497555-53497577 ATGGAGGAGAAGGCCTAGCAGGG - Intronic
1138121507 16:54404183-54404205 ATGGAGGAAGAGGCTTACAAGGG + Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1139257825 16:65559896-65559918 ATTGAGAAAAAGGCTTAACTCGG + Intergenic
1139278569 16:65750267-65750289 ATGAGGAAACAGGCCCAGCAAGG + Intergenic
1139497043 16:67327185-67327207 AAGGAGAAACAAGGTTAACAGGG + Intronic
1141000450 16:80302666-80302688 ATGGACAAGCAGGCTGGGCATGG - Intergenic
1141191648 16:81829397-81829419 ATGGTGAAACTGGCTAGGCACGG - Intronic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1142292228 16:89198452-89198474 CTGGAGAAACGGGCTTATCTTGG - Exonic
1142858618 17:2747976-2747998 ATGAGGAGACAGGCTTAGAAAGG + Intergenic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143392379 17:6567314-6567336 ATAAGGAAACAGGCTTAGAAAGG + Intergenic
1144583808 17:16475754-16475776 TTGTAGAAACGGGCTGAGCACGG + Intronic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1144962195 17:19051078-19051100 ATGAAGAAACAGGCCAGGCATGG + Intergenic
1144972966 17:19123442-19123464 ATGAAGAAACAGGCCAGGCATGG - Intergenic
1145051540 17:19665876-19665898 ATGGAGCAACTGACTTAGGACGG - Intronic
1146287168 17:31581796-31581818 ATGAGGCAACAGGCTCAGCAGGG - Intergenic
1146405148 17:32530224-32530246 ATGGACAAAAAGGCTTAGAGAGG - Intronic
1146610243 17:34298653-34298675 AGGAAGAAAAAGGCTGAGCATGG - Intergenic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1148355267 17:46971659-46971681 ATGAAGAAACAGGCCTTGGAAGG + Intronic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1151780610 17:76242478-76242500 ATGGAGAAGCTGGCTTCCCAGGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1156675739 18:39525185-39525207 ATGGAGAAAGAGGCTTCTCAAGG - Intergenic
1157130318 18:45001243-45001265 ATGGGGAAACAGGCTTTGAGTGG - Intronic
1157155927 18:45266041-45266063 AAGGAGAATCAGGCTCACCAGGG + Intronic
1157561332 18:48648522-48648544 AAAGAGAAACAGGCCTATCATGG - Intronic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1158360356 18:56665792-56665814 ATGGAGACTCAGGCTTATTAGGG + Intronic
1159026547 18:63187673-63187695 ATGGAGACAGAGGCTTGGAATGG + Intronic
1160162476 18:76484168-76484190 ATGGAGAAAAAGGCTAAGCTGGG + Intronic
1160928810 19:1560111-1560133 GTGAAGAAACAGGCATAGCAAGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1163597497 19:18228701-18228723 ATGGAGAAAGAGTCACAGCAAGG + Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1164953878 19:32363983-32364005 ATGGGAAAAGAGGCTTAGTATGG - Intronic
1165699923 19:37929685-37929707 AGGGGGAAACAGCCTTTGCAAGG - Intronic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1166799869 19:45450187-45450209 ATAGAGATACAGGGCTAGCAAGG - Intronic
1167437833 19:49490205-49490227 AGGGAGGGAAAGGCTTAGCAGGG - Intronic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168280604 19:55303568-55303590 ATGGGGAAACAGGCCTAGAGTGG - Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168307670 19:55444196-55444218 AGGGAGATACAGGCTGAGAAAGG + Intergenic
1168679380 19:58303116-58303138 AAGAAGAAACAGGCTAGGCAAGG + Intronic
926046718 2:9715399-9715421 TTGGAGAAACAGACTCAACAAGG - Intergenic
926110662 2:10181224-10181246 ATGAGGAAACAGGCTTAGAGTGG + Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
930301794 2:49625593-49625615 ACACAGAAATAGGCTTAGCAAGG - Intergenic
930352057 2:50269093-50269115 ATGGGGAAACAGACTTAGACAGG + Intronic
930956610 2:57210502-57210524 ATGGGGAAAGAGCCTTAGAATGG - Intergenic
932428967 2:71662074-71662096 ATGGGGAAACAGGCATGGGAGGG - Intronic
933223709 2:79720739-79720761 ACTGATAAACAGGTTTAGCAAGG - Intronic
933853285 2:86388496-86388518 ATTTAAAAACAGGCTAAGCATGG - Intergenic
936660046 2:114533069-114533091 ATTGAGAATCATGCTTACCAAGG + Intronic
936742988 2:115537367-115537389 AAGTAGAAATAGGCTTAGCATGG + Intronic
937541340 2:122957995-122958017 ATGGACAAGAAGGCTTATCAAGG + Intergenic
937763727 2:125635117-125635139 ATGCAGAAACAGGGATAGCCAGG - Intergenic
939577854 2:143917663-143917685 ATGGGGAATCAGCCTTAACAGGG - Intergenic
941473983 2:165925443-165925465 ATAAAGAAACAGCCTTAGTAAGG - Intronic
941658829 2:168173453-168173475 ATGGAAGAACAGGATTAACAAGG + Intronic
942242471 2:173975691-173975713 ATCAAGAAGCAGGCTAAGCATGG + Intergenic
943177281 2:184492901-184492923 ATAGAGAAACAGGCCAGGCATGG + Intergenic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945130168 2:206562746-206562768 TTGGAGAAAAAGGCTTTGCAAGG + Intronic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
946106774 2:217377495-217377517 ATGGAGAAAAAAGCAAAGCAGGG + Intronic
947768409 2:232652035-232652057 ATGGAGAAACAGGCCCACCAAGG - Intronic
948694080 2:239724461-239724483 AAGGAGAGACAGGGTTTGCAGGG - Intergenic
948880891 2:240856616-240856638 ATGCAGCAGCAGGCTCAGCATGG + Intergenic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1168731134 20:82027-82049 AAGGAGAAATAGGCTGGGCATGG + Intergenic
1168749676 20:273583-273605 ATGCAGAATCAGGCTGGGCATGG + Intronic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1170341932 20:15338668-15338690 ATGAAGAAACAGGCCTAGGGGGG + Intronic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1172384226 20:34522262-34522284 ATGGGGAAACAGGTTTGGAAAGG - Intronic
1172527864 20:35611379-35611401 ATGGAGAAATAGGCAGAACAGGG - Intergenic
1172965873 20:38834371-38834393 GTGGAGGAACAGGCTTAGAGAGG + Intronic
1173534289 20:43797635-43797657 AAGGAGAAACAGGCATCACAAGG - Intergenic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174307280 20:49622649-49622671 ATGAGGAAACATGCTCAGCAAGG - Intergenic
1174462686 20:50694010-50694032 AGAAAGAAACAGGCTGAGCATGG + Intergenic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176261691 20:64185267-64185289 ATGGACAAGCTGGCTCAGCAGGG + Intronic
1177119031 21:17119640-17119662 ATTGCAAAATAGGCTTAGCAGGG + Intergenic
1181116053 22:20633100-20633122 CTGGAGAAACAGGCCAGGCAAGG + Intergenic
1181585670 22:23852099-23852121 ATGGGCAAACAGGCTTGACACGG - Intergenic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182777194 22:32839837-32839859 AAGGAAACACAGGCTTAGGAAGG - Intronic
1183207661 22:36430848-36430870 TTGAAGAAACTGGCTGAGCACGG - Intergenic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1184095470 22:42314081-42314103 AGGCAGATACAGGCTCAGCAGGG + Intronic
1184391100 22:44204133-44204155 AAGAAGAAACAGGCTAGGCACGG - Intronic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1184933797 22:47703519-47703541 ATGGAGACTCAGGCTGTGCATGG - Intergenic
949761663 3:7477786-7477808 CTGGAGATACAGGCTTCACAAGG - Intronic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951717154 3:25662191-25662213 ATAAAAAAACAGGCTTAGAAAGG + Intronic
952577830 3:34795833-34795855 ATGGAGACTCAGGCTTGGAAAGG - Intergenic
952783867 3:37132663-37132685 ATGGATAAGCAGGAGTAGCAAGG + Intronic
952931674 3:38365599-38365621 ATGGAGAAACAGTCCTGGGAAGG - Exonic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
954792351 3:53142776-53142798 ATGGGGAAACAGGCTCTGCAGGG - Intergenic
954935438 3:54322486-54322508 ATGACCAAACAGGCTTGGCAGGG + Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956687061 3:71839892-71839914 ATAGAGAAACAGGCTTAGAGAGG + Intergenic
957117673 3:76047210-76047232 ACTGAGAAATAGGATTAGCATGG - Intronic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
960108650 3:113824131-113824153 ATAGAAAAACAGGCTTAGGCTGG - Intergenic
960579556 3:119264582-119264604 AAGAAGAAATAGGCTGAGCACGG + Intergenic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
964419090 3:156482461-156482483 ATGGAGAAACAAACTAATCATGG + Intronic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965991166 3:174819934-174819956 ATGGAGAAATTGGATTAGGAAGG - Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968631055 4:1651752-1651774 AGGGACACACAGGCTCAGCAAGG + Intronic
968729065 4:2261341-2261363 CTGGGGAAACAGGCTCAGCCAGG - Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970232359 4:13923847-13923869 ATGAAAAAACTGGCATAGCATGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
971570646 4:28206347-28206369 AAGTAGAAAGAGGCTAAGCATGG - Intergenic
971742944 4:30543168-30543190 ATAATGAAACAGGCATAGCAGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
974034619 4:56807033-56807055 AAGAAGAAACAGGCTGGGCACGG + Intergenic
974132503 4:57774042-57774064 ATGGGGAAACAGGCATAAAATGG + Intergenic
974171857 4:58276993-58277015 ATGGAGAAAATGTCTTAGCTTGG - Intergenic
975765387 4:77662227-77662249 ATGAAGAAACAGGATTCGCAAGG - Intergenic
975969998 4:80022029-80022051 ATGAAGAAACAAGCTTATAAAGG + Intronic
977191996 4:94012540-94012562 ATGAGGACACAGGCTCAGCATGG + Intergenic
978425215 4:108575058-108575080 ATGGGGAGCCAGGCTTGGCATGG - Intergenic
978545269 4:109865184-109865206 ATGAGAAAACAGGCTCAGCAAGG + Intronic
978884459 4:113750443-113750465 ATGCAGAAACAGGCTTGGGGAGG - Intronic
979616545 4:122748900-122748922 ATGAGGAAATTGGCTTAGCATGG + Intergenic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
983301737 4:165934303-165934325 ATGGAGAATGAGGCCAAGCATGG - Intronic
983637856 4:169916510-169916532 ATGAAGAAAAAGGCTTATGAAGG - Intergenic
984103548 4:175516267-175516289 TTGAAGAAACAGGCTTAGGTTGG - Intergenic
984191278 4:176608705-176608727 GTGTAGACACAGTCTTAGCAAGG + Intergenic
984267827 4:177515507-177515529 ATTGAAAATCAGGCTTGGCATGG + Intergenic
984632565 4:182076181-182076203 AAGGAGAAAGAGGCTGGGCATGG - Intergenic
986492142 5:8304215-8304237 AAGGAGAAACAAGGTTAGCAAGG - Intergenic
986668365 5:10122773-10122795 ATGGAAATACAGGCCTGGCATGG + Intergenic
986681829 5:10240541-10240563 ATGAGAAAACAGGCTCAGCAAGG - Intronic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987431094 5:17834125-17834147 ATGGAGAAACATGCTATGAATGG - Intergenic
988462576 5:31453711-31453733 AAGGAGAAACAGGCTTTGTTTGG - Intronic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
990697678 5:58439150-58439172 ATGATGAAACAGGCTTTGCTTGG + Intergenic
990820266 5:59831579-59831601 ATGGGAAAACAGGCTTAGTGAGG + Intronic
991341457 5:65615190-65615212 ATAGAGAAATAGGCTGGGCACGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993198017 5:84775364-84775386 ATGAAGAAACAAGTTTAGAATGG + Intergenic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993981818 5:94551630-94551652 ATGGAGAAACAGTCTTTCCCAGG + Intronic
994603545 5:101938732-101938754 ATGGATAAACAGTCTTAGTAAGG - Intergenic
996439805 5:123477477-123477499 ATCGAGAAACAGGCCAAGAAGGG - Intergenic
996955275 5:129176005-129176027 ATTGAGAAACAGTCATAGCCTGG - Intergenic
997631071 5:135369339-135369361 ACGGATAAACAGGGTTACCAGGG - Intronic
997728932 5:136150208-136150230 CTGGAGATACAGGTTTAGCCAGG - Intronic
998930361 5:147174562-147174584 AAGAAGAAACAGGCTTAGAAAGG + Intergenic
999115481 5:149159883-149159905 ATGGAGAAACAGCATTTGCAAGG - Intronic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1000017929 5:157294755-157294777 ATGGTAAAACAGCCTCAGCAGGG - Intronic
1000315551 5:160087084-160087106 ATGGAGACACTGGCCGAGCACGG + Intronic
1000740153 5:164959165-164959187 ATAAGGAAACAGGCTTTGCAAGG - Intergenic
1001137762 5:169116718-169116740 AGGGAGAAACAGGCTAATCAGGG + Intronic
1001853062 5:174986131-174986153 ATGGTAAAACATGCTTAGCAGGG - Intergenic
1002139179 5:177128382-177128404 ATGGAGACACAGGCTTGGAGAGG + Intergenic
1003959930 6:11199372-11199394 ATGAGAAAACAGGCTTAGAATGG - Intronic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1004578953 6:16928762-16928784 AGAGAGAAACAGACATAGCAGGG + Intergenic
1005184390 6:23148632-23148654 ATGGATAAATAGGCTAGGCATGG - Intergenic
1005286302 6:24330729-24330751 ATGGAGAAACAGGATCCACAGGG + Intronic
1005596435 6:27382827-27382849 ATTGAAAAGCAGGCTGAGCACGG + Intronic
1007270656 6:40634578-40634600 AGGCAGAGACTGGCTTAGCAGGG + Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008489978 6:52076601-52076623 AGGTAGAAACAGGCTTGTCAAGG - Intronic
1008584324 6:52935169-52935191 ATGGAGCTACAGGGTTAGGAGGG + Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1011874638 6:91942784-91942806 TTTGAGAAACAAGCTTAGCTAGG + Intergenic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013967551 6:115972759-115972781 ATGTAAAATCATGCTTAGCATGG - Intronic
1015144266 6:129968024-129968046 CTGGAGAAACAGAGTTTGCAAGG + Intergenic
1015170195 6:130243552-130243574 GTTAAGAAACAGGCTTAGCAAGG + Intronic
1016379467 6:143460031-143460053 AAAGAAAAACAGGCTTTGCATGG - Intronic
1016581063 6:145629740-145629762 CTGGAGAGACAGGCACAGCAGGG - Intronic
1017539648 6:155387392-155387414 ATGAAAAAATAGTCTTAGCAAGG - Intergenic
1018977846 6:168579070-168579092 ATGGGGAAACAGGCTTTAAAAGG + Intronic
1019026649 6:168971279-168971301 ATGGTGGAACAGACATAGCATGG + Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020032121 7:4940544-4940566 AGGGGGAGAGAGGCTTAGCACGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022066280 7:26861349-26861371 ATGGAAAAACAGGTTTAGCCTGG - Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031074885 7:117202441-117202463 AAGGAGGAAGAGGCTTAGCAGGG - Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032324664 7:130916015-130916037 ATGATGAAACTGGCTTAGCGAGG - Intergenic
1033032528 7:137841266-137841288 ATGGGCAAACAGACTTAGCTTGG + Intronic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033415135 7:141155332-141155354 AGGGAAAAACAGAATTAGCAAGG - Intronic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1036990334 8:13585271-13585293 ATGAAGAAATAGGCCTAGCATGG + Intergenic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038401246 8:27286537-27286559 GTGGGGAAACAGGCCTGGCAAGG + Exonic
1039909256 8:41811120-41811142 ATAGAAAAACAAGCTAAGCATGG + Intronic
1040973565 8:53164455-53164477 TGGGAGAAACATGCATAGCAAGG + Intergenic
1041794261 8:61729536-61729558 ATGGAGAAACATGCTCAGAGAGG + Intergenic
1042799475 8:72703146-72703168 ATGGAGAAAATGGCATAGCTAGG - Intronic
1043975175 8:86577056-86577078 ATTGAGAAACAGACAGAGCAGGG - Intronic
1044481206 8:92691052-92691074 ATTATGAAACAGGCTAAGCAAGG - Intergenic
1046154843 8:110274805-110274827 ACTGGGAAACAGGCTGAGCATGG + Intergenic
1046803169 8:118451087-118451109 GTAGAGAAACATGCTTAGAAAGG + Intronic
1049048222 8:140169891-140169913 ATGCAGAAACTAGCTGAGCATGG - Intronic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1055576119 9:77661654-77661676 GGGGACAAACAGGCTGAGCAAGG + Intergenic
1055602243 9:77931763-77931785 ATGAAGAAGCAGGCTTAGAGAGG - Intronic
1056069436 9:82970531-82970553 ATAAAGAAACAGGCTTAGCCGGG - Intergenic
1056638484 9:88350372-88350394 CTAGAGAACCAGGCTTAGAAAGG - Intergenic
1056693254 9:88825750-88825772 ACGGTGAAACAGGCATAGGACGG - Intergenic
1057817721 9:98307941-98307963 ATGGGGAACCAGGCTAGGCATGG + Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059352563 9:113676048-113676070 GTGGAGAAATAGGCTGGGCATGG + Intergenic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059717354 9:116925677-116925699 ATGGAAAAATAGGAGTAGCAGGG - Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060429173 9:123534223-123534245 ATTGAGAAAAAGTCTTAGTAGGG - Intronic
1060563461 9:124567883-124567905 AAAGAGAAACAGGCTGGGCACGG + Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060835377 9:126751729-126751751 ATGGAGATACATGCTTGGAAAGG + Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061193188 9:129094052-129094074 ATGAGGAAGCAGGCTTAGCGAGG - Intergenic
1186000878 X:5009080-5009102 ATGGATAAGCAGGCTTGGCATGG + Intergenic
1186196724 X:7116535-7116557 ATGGTGAATGAGGCTGAGCAGGG - Intronic
1186202128 X:7165356-7165378 AAGGAGTAACAGGCTGGGCATGG + Intergenic
1187319590 X:18227755-18227777 AAGGGGAGACAGGCTGAGCATGG + Intergenic
1187768447 X:22668926-22668948 ATGGAGAAATAAACTGAGCAAGG - Intergenic
1187862601 X:23696583-23696605 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1190114405 X:47616988-47617010 ATGGAGGAAAAGGTATAGCAAGG + Intronic
1193268897 X:79506641-79506663 GAGGAGAAAAAGGCTTAGAAAGG - Intergenic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1193801122 X:85937544-85937566 ATGGAAAATCAGGCTGGGCATGG + Intronic
1194062281 X:89218485-89218507 CTGGCTAAACTGGCTTAGCAGGG - Intergenic
1194486327 X:94491632-94491654 ATGTTGAACCAGTCTTAGCAAGG + Intergenic
1195696432 X:107671049-107671071 ATGGAGACACAGGCATGGCAAGG + Intergenic
1195842434 X:109188895-109188917 AAGGTGAAACAGGCTAACCAAGG - Intergenic
1195864233 X:109412150-109412172 ATAGAGAGATAGGCTTAGAATGG + Intronic
1196731717 X:118947582-118947604 ATGGAGAATCAGGCTGGGCATGG + Intergenic
1197067284 X:122248499-122248521 TTGGACAAACAGGCTAAGCATGG - Intergenic
1198295864 X:135285703-135285725 ATTTGGAAACAGGCTTAGAACGG + Intronic
1201175462 Y:11306471-11306493 AGGGAGAAACCGGCTTGGGAGGG - Intergenic