ID: 1138489171

View in Genome Browser
Species Human (GRCh38)
Location 16:57366220-57366242
Sequence GCCCCCTGCCCCATCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 330}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138489171_1138489175 3 Left 1138489171 16:57366220-57366242 CCCTGTGAGATGGGGCAGGGGGC 0: 1
1: 0
2: 3
3: 35
4: 330
Right 1138489175 16:57366246-57366268 ATGATCCCCTCTATCCCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 83
1138489171_1138489174 2 Left 1138489171 16:57366220-57366242 CCCTGTGAGATGGGGCAGGGGGC 0: 1
1: 0
2: 3
3: 35
4: 330
Right 1138489174 16:57366245-57366267 CATGATCCCCTCTATCCCACTGG 0: 1
1: 0
2: 2
3: 5
4: 105
1138489171_1138489182 25 Left 1138489171 16:57366220-57366242 CCCTGTGAGATGGGGCAGGGGGC 0: 1
1: 0
2: 3
3: 35
4: 330
Right 1138489182 16:57366268-57366290 GGAAGCCTTCCCATTGAAATAGG 0: 1
1: 0
2: 8
3: 460
4: 264
1138489171_1138489176 4 Left 1138489171 16:57366220-57366242 CCCTGTGAGATGGGGCAGGGGGC 0: 1
1: 0
2: 3
3: 35
4: 330
Right 1138489176 16:57366247-57366269 TGATCCCCTCTATCCCACTGGGG 0: 1
1: 0
2: 1
3: 12
4: 106
1138489171_1138489183 28 Left 1138489171 16:57366220-57366242 CCCTGTGAGATGGGGCAGGGGGC 0: 1
1: 0
2: 3
3: 35
4: 330
Right 1138489183 16:57366271-57366293 AGCCTTCCCATTGAAATAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138489171 Original CRISPR GCCCCCTGCCCCATCTCACA GGG (reversed) Intergenic
900359310 1:2280393-2280415 GACCACAGCCCCTTCTCACAAGG + Intronic
900370088 1:2328394-2328416 GCCTCCTGCCCCTTGTCACCAGG - Intronic
900488796 1:2936032-2936054 CTCCCCTGCCCCATGTCAGAGGG - Intergenic
901324261 1:8357572-8357594 ACCCCCTGCGCCATCTCACCAGG + Intronic
903145729 1:21370834-21370856 GCCCCATTCCCCACCCCACAGGG - Intergenic
903285309 1:22273339-22273361 GCCCCCTGTCCCCTGACACACGG + Intergenic
904255785 1:29253955-29253977 GCCACCTGCCCCTGGTCACAAGG + Intronic
905790154 1:40785186-40785208 GCCCCCTCCTCCCTCTCACCAGG + Intronic
905812635 1:40923715-40923737 GCCCCCATTCCCATCCCACAAGG - Intergenic
906072740 1:43029023-43029045 GCTACCTGCCCCAGGTCACACGG - Intergenic
907284451 1:53370981-53371003 TCCCCCTGCCGTATCCCACAGGG + Intergenic
907418337 1:54329794-54329816 GTCCCCTCCCCCATTTCTCAGGG - Intronic
907603530 1:55793836-55793858 GGCTCCTGCCCCAACTCAGAAGG - Intergenic
908523367 1:64966048-64966070 GCCCCCTCCCCCAGCGCGCACGG - Intronic
910713501 1:90205505-90205527 GCCCCCGTCCCCATCACTCATGG + Intergenic
911130921 1:94387398-94387420 GCTCCCTGCTGCATCCCACATGG + Intergenic
912495032 1:110086015-110086037 GACCCCTGCCCCAGCCCAGAAGG - Intergenic
912554499 1:110506466-110506488 GCCCCCTGCCCCCTCTCCAAAGG + Intergenic
913003917 1:114609271-114609293 GCCCCCTGCCCCGTGCCACCTGG - Intronic
913520253 1:119638830-119638852 GCCTCCTGTCCCTTGTCACATGG - Intronic
914681321 1:149940466-149940488 GCTCTCTGCCCCATCTCCAATGG - Exonic
914922965 1:151859939-151859961 GCCCCCTGGGCCATGGCACAGGG + Intergenic
915915227 1:159936799-159936821 GCCCCCTGCCTCATGTGACGTGG - Exonic
916574856 1:166058304-166058326 GCCCTATGTCCCATCTCTCAGGG - Intronic
916746169 1:167686527-167686549 CTCCCCTCCCCCATCTCACTTGG - Intronic
918042730 1:180923062-180923084 GCCCCATGCCTCTCCTCACATGG - Intronic
918134457 1:181659193-181659215 GTGGCCTGCCCCCTCTCACATGG - Intronic
919755880 1:201066114-201066136 GACCCCTGTCCCATCTCCCTGGG - Intronic
920080295 1:203368249-203368271 GCGCCTTGCCCCATTTCACCAGG - Intergenic
920682125 1:208081356-208081378 GCCCCCTACCCCATCTCCATTGG + Intronic
921198173 1:212779354-212779376 GCCAGCCGCCCCATCTCAGAGGG + Intronic
921672991 1:217946863-217946885 CCTCCCTGCTCCATCTCCCACGG - Intergenic
922453536 1:225755926-225755948 GCCCCCTGCCCCAGCATCCAGGG + Intergenic
1063300342 10:4844945-4844967 GCCCCCTGCTCCATGGCACCAGG - Intronic
1063973411 10:11397081-11397103 ACCCCCTGCCCAAAGTCACACGG + Intergenic
1064428948 10:15254981-15255003 CCACCCTGCTCCCTCTCACAAGG + Intronic
1067030633 10:42877144-42877166 GACCCATGCCCCAGCTCAAAGGG - Intergenic
1067345350 10:45434162-45434184 GGCCCCTGCCCCGTCTCAATTGG + Intronic
1067527525 10:47047433-47047455 TCCTCCTGCCCCACCTCCCATGG - Intergenic
1067529948 10:47063103-47063125 GGCCCCTGCCCCAGCACACGTGG + Intergenic
1067683769 10:48455580-48455602 GCTCCCTGGCCCATGTCCCAGGG - Intronic
1067690202 10:48496990-48497012 GCCCACTGCTCCATCCCCCAGGG + Intronic
1067879975 10:50034776-50034798 TCCCCCTCTCCCCTCTCACATGG - Intergenic
1067891908 10:50144604-50144626 TCCCCCTCTCCCCTCTCACATGG + Intergenic
1068033841 10:51735824-51735846 GCCCCCTGCCCCATATCCATGGG - Intronic
1069635927 10:69924870-69924892 GCCTCCTGGCCCTTATCACATGG + Intronic
1069703056 10:70440455-70440477 GCCCCCGGCACCAGGTCACAAGG + Intronic
1069791746 10:71027055-71027077 TCCCTCTGCCTCATCTTACAAGG - Intergenic
1070156082 10:73836486-73836508 GCCCCCAGCTCCATGTCAGAGGG + Intronic
1070157165 10:73842380-73842402 GGCTCCTGCCCCATTTCAGAAGG - Intronic
1070573205 10:77657215-77657237 GGTCCCTGCTCCATCTCACGAGG + Intergenic
1070714331 10:78708206-78708228 TCCCCCAACCCCATCCCACATGG - Intergenic
1070824305 10:79381889-79381911 GGCCCCTGCCCCGTCTCCCCTGG + Intergenic
1071510970 10:86262429-86262451 GCCCCCTGGTCCATGCCACAGGG + Intronic
1073115795 10:101090844-101090866 GCCCCCTCTGCCATCTCACTTGG - Intronic
1073150582 10:101308763-101308785 GCCCCATCCCCCATCTCCCTGGG + Intergenic
1074149000 10:110741714-110741736 GCCCCCTGCCCCCCATCACCTGG + Intronic
1074336013 10:112576317-112576339 GCCCCCTGCCTCTTCTAAAAGGG + Intronic
1074847628 10:117412325-117412347 GGCTCCTGCCCCATCACAAATGG + Intergenic
1076826703 10:132973118-132973140 GCCCCGTCCCCCAGCACACAAGG + Intergenic
1077192790 11:1262422-1262444 GCCCCCTGCCCCCTGTCCCCTGG - Intergenic
1077384910 11:2264246-2264268 CCCCCCTGCCCCAGCTCTGAGGG + Intergenic
1077473388 11:2775327-2775349 GTCCCCTGCCCTGCCTCACATGG + Intronic
1078329440 11:10407778-10407800 GCCCCCGGCCCCATCCCTCTTGG + Intronic
1078417209 11:11175557-11175579 TCCCCCTGCCCCTTCTAATAAGG - Intergenic
1078721085 11:13883685-13883707 GGCACCTGCCCCATGTTACAAGG - Intergenic
1079401877 11:20112459-20112481 CCACCCTGCCCCTTCTCAGATGG - Intronic
1082828541 11:57598332-57598354 CCCCCGTCCCCCATCCCACAAGG - Intronic
1083418905 11:62542686-62542708 GTCCCCAGCCCCCTTTCACAAGG - Intronic
1083763966 11:64833375-64833397 GCCCCATGCCCCATCCCTGAGGG + Intronic
1084033091 11:66492476-66492498 GCCGCCTGCCCCTTCTCCCTGGG - Intronic
1084433275 11:69123228-69123250 GCCCACTCCCGCCTCTCACAGGG - Intergenic
1084671903 11:70611947-70611969 CCCCCCTCCCCCACCTCCCATGG - Intronic
1088714047 11:112533257-112533279 TCCCCTTGCTCCATCTCACCTGG + Intergenic
1089126688 11:116181222-116181244 GCCTGCTCCCCCATCACACAAGG + Intergenic
1089433006 11:118437678-118437700 CCCCCCCGCCCCGTCTTACAGGG + Intronic
1089762538 11:120738850-120738872 CCCTCCTCCCCCATCTCACCAGG - Intronic
1091262018 11:134242152-134242174 ACCACCTGCGCCATCTTACAGGG - Intronic
1091585891 12:1816452-1816474 GCCTCCTGCCCCAGCTGACCTGG + Intronic
1092192870 12:6533383-6533405 GTCCCCTGCCCCCTCCCACAGGG - Intergenic
1096982205 12:55734805-55734827 ACTCCCTTCCCCACCTCACAGGG + Intergenic
1098131858 12:67359383-67359405 GCCTCCTGCCCCATCTCTTGCGG - Intergenic
1098805941 12:75020206-75020228 GCCCCCAGCCCCATCGCTCCTGG - Intergenic
1099191444 12:79565283-79565305 GCCCCCTGCTCCATGGCACCTGG + Intergenic
1101121196 12:101582007-101582029 GCACCCTGCCCCTCCTCACAGGG - Intronic
1101597614 12:106180864-106180886 GTCCCCTCTTCCATCTCACAGGG + Intergenic
1101609697 12:106279315-106279337 GCCCCTGGCCCCATCTCATGGGG + Intronic
1101751391 12:107585494-107585516 GTCCCCTCCCCCATCTCACAGGG + Intronic
1102698000 12:114815157-114815179 TCCCCCTGCCACCTGTCACATGG + Intergenic
1103541375 12:121668889-121668911 ACCCCCTACTCCATCCCACAAGG - Intronic
1103800522 12:123534187-123534209 GCCCCCGGCCCCCTCTCCCGGGG - Intergenic
1104397302 12:128445456-128445478 AACCCCTGACCCATCACACACGG - Intronic
1104904312 12:132205255-132205277 GCCCCCTGCTCCCCCACACAAGG - Intronic
1104968688 12:132521414-132521436 GACCTCTGCCCCATCTCCCAGGG + Intronic
1108699142 13:52928952-52928974 TCCACCTGCCTCATCTCACACGG - Intergenic
1110854155 13:80278685-80278707 GCCCCCTGCTCCATGGCACCCGG - Intergenic
1113436312 13:110294256-110294278 GCCTCCAGCCCCTTCACACAGGG + Intronic
1113446498 13:110372210-110372232 GTCCTCTGCCCCCTCTCTCAAGG - Intronic
1113633198 13:111901812-111901834 GCCCCCTGCCCCCTTCCACAGGG - Intergenic
1115975511 14:38992390-38992412 GGCCCCTGCTGCATCTCATATGG - Intergenic
1116030112 14:39561076-39561098 TTCCCCTTCCCCACCTCACAAGG - Intergenic
1118346525 14:64945201-64945223 ACCACCCTCCCCATCTCACACGG + Intronic
1119415611 14:74467438-74467460 GCCCCCTGCCCCCTCTCCTGGGG - Intergenic
1119894048 14:78205065-78205087 GCCCGCTGCCCCAGCCCACAGGG + Intergenic
1121585700 14:95061580-95061602 GCCCTCTGCTCCACCTCTCAGGG + Intergenic
1121607977 14:95255117-95255139 GTCCCCTGCCCCTCCTCTCATGG - Intronic
1122024817 14:98867993-98868015 GCCCCCTGCCCGTTCTCATGTGG + Intergenic
1122155295 14:99746982-99747004 GCGCTGTGCCCCATCTCACAAGG + Intronic
1124595208 15:31086438-31086460 GCCCCCTGCCCCATCGCAGAGGG + Intronic
1126351841 15:47752050-47752072 GAGTCCTGCCCCCTCTCACAAGG - Intronic
1126497812 15:49311945-49311967 GCCCCCGGCCCAATCTCTCAGGG - Intronic
1127070441 15:55283269-55283291 CTCCCCTGCCCCACCCCACATGG - Intronic
1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG + Intronic
1129738851 15:77980167-77980189 GGCCCCTTCCCCATCTCCCCTGG + Intergenic
1129847109 15:78773014-78773036 GGCCCCTTCCCCATCTCCCCTGG - Intronic
1130033157 15:80333902-80333924 GCCCTATGCCACATCTCAAATGG + Intergenic
1130224636 15:82047278-82047300 GCCCCCTCCCGGATCTCCCAGGG + Intergenic
1130254793 15:82320876-82320898 GGCCCCTTCCCCATCTCCCCCGG + Intergenic
1130600180 15:85269130-85269152 GGCCCCTTCCCCATCTCCCCCGG - Intergenic
1131060062 15:89399242-89399264 CCCCCCTCCCCCACCACACACGG - Intergenic
1132618921 16:855323-855345 GCCCCCACCCCCATCTCCCCTGG + Intronic
1132838842 16:1968468-1968490 GCCCCCTGGCCCATCGCAAGGGG + Exonic
1132882124 16:2167147-2167169 GCCCCATGGCCCCTGTCACACGG + Intronic
1132983881 16:2753335-2753357 GCCCCCTCCCCCATTCCGCAAGG + Intronic
1133221699 16:4321675-4321697 GACCCCTGCCCCAGTTCCCACGG - Intronic
1133326344 16:4944609-4944631 GCCACCTGCCCAAGGTCACACGG - Intronic
1133327894 16:4953294-4953316 GCCACCTGACCCCTCCCACAGGG + Intronic
1134824594 16:17274446-17274468 TTCCCCTGCCCCATCTGTCAGGG - Intronic
1135537787 16:23307636-23307658 GCCCCTTGACCTAACTCACATGG + Intronic
1136537828 16:30910674-30910696 GCCCCCTGCTCCGCCCCACAGGG + Intergenic
1136616667 16:31402338-31402360 CACCCCAGCCCCATCACACACGG - Intronic
1137481014 16:48852161-48852183 GGCCCTGGCCCCATCTCAGAAGG + Intergenic
1137945738 16:52731737-52731759 GCCCCCTGCTCCATGGCACCCGG + Intergenic
1137980653 16:53066554-53066576 GGCTCCTGCCCGGTCTCACAGGG + Intronic
1138489171 16:57366220-57366242 GCCCCCTGCCCCATCTCACAGGG - Intergenic
1139972720 16:70786219-70786241 GCCGCCTGCTCCATCGCACTGGG - Exonic
1140211690 16:72975533-72975555 GGCCCCTTCTCCATCCCACATGG + Intronic
1140218805 16:73028725-73028747 GCCCACTGCCCCCTTTCCCAGGG - Intronic
1140997933 16:80279137-80279159 GCCCCCACCCCCACCTCAAAAGG - Intergenic
1142152063 16:88517013-88517035 GCGACCTGCCCCAGGTCACACGG - Intronic
1142883941 17:2901228-2901250 AGGCCCTGCCCCTTCTCACATGG - Intronic
1143495107 17:7308105-7308127 GCCCCCTCCCCCACCTCACGTGG - Intronic
1143584723 17:7845393-7845415 GCCCCCTGCCCCAGCTCTCTGGG - Exonic
1143675697 17:8430889-8430911 GCCCCTGGGCCCATCTCCCAGGG + Intronic
1143708602 17:8718108-8718130 GCCCCCTGCTCCATGGCACCCGG - Intergenic
1144465733 17:15495657-15495679 GCCCCCTGCTCTCTCTCACAAGG - Intronic
1144737747 17:17564373-17564395 GCCCTCTTCCCCATCTCCCTTGG + Intronic
1146415983 17:32633685-32633707 GCCCCCACCCCCATCCCAGAAGG + Intronic
1146519919 17:33518378-33518400 GCCCCCTGCCACATCATGCAGGG - Intronic
1147248541 17:39138636-39138658 GCCCCCTTCCCTTTCTCAGAAGG - Intronic
1147430392 17:40367126-40367148 GCCCCCTGCCCCCAGCCACAGGG + Intergenic
1147638061 17:41975971-41975993 GCCACCTGTCCCACCTCAAATGG + Exonic
1148561906 17:48611173-48611195 GCCCCCAGCCCCAATCCACAGGG - Intronic
1148712001 17:49688754-49688776 CCCTCCTGACCCACCTCACACGG - Intergenic
1148786052 17:50146764-50146786 GCCCACTGCCCAAGGTCACATGG + Intronic
1149602889 17:57904583-57904605 GCTCCCCGTCCCATTTCACAGGG + Intronic
1149850551 17:60031185-60031207 GCCTCTTGGCCCATCTCTCATGG - Intergenic
1149859615 17:60115339-60115361 GCCTCTTGGCCCATCTCTCATGG + Intergenic
1152642257 17:81454173-81454195 TCCCACTGCCCCATTTCACATGG - Intronic
1152723167 17:81932753-81932775 ACCCTCTGGCCCTTCTCACACGG + Intronic
1152797248 17:82314481-82314503 CCTCCCTGCCCCGTCTTACAAGG - Intergenic
1154056732 18:11019694-11019716 CCCCCCTACCCCAACACACAAGG + Intronic
1154397189 18:14001596-14001618 GCCCTCTGCCTCACCTCACCTGG + Intergenic
1157504604 18:48217702-48217724 CCCCACTGCCCCAACTCACAGGG + Intronic
1159942139 18:74416343-74416365 GCCACCTGCCACAGGTCACAGGG + Intergenic
1159949790 18:74474590-74474612 GCAGCCTGCACCATCACACAGGG - Intergenic
1159970491 18:74646834-74646856 GCCCCCAGCTCCTCCTCACAGGG + Intronic
1160183730 18:76658787-76658809 CCCTCCTTCTCCATCTCACAGGG + Intergenic
1160622303 18:80179934-80179956 GCTGCCTGGCCCATCTCAGAGGG + Intronic
1160966927 19:1750741-1750763 TCCCCCTTCCCCACCCCACAGGG - Intergenic
1161026737 19:2040440-2040462 GCCCCAAGCCCCATCTCTCCCGG + Intronic
1161086724 19:2338871-2338893 GCCCCCTGCCCCATCTCCTCGGG - Intronic
1161452452 19:4354150-4354172 TGCCCCTGCCCCAGCTCACCTGG + Intronic
1162070891 19:8151543-8151565 CCCACCTGACCCTTCTCACAGGG - Intronic
1162930339 19:13954276-13954298 GCCCCCAGCCCCCTCACCCACGG - Intronic
1163334384 19:16661338-16661360 GCCCCCCGCCCCGGCTCACCTGG - Exonic
1163584811 19:18157792-18157814 GCCACCTGGCCCATCACTCAGGG + Intronic
1163719365 19:18891388-18891410 CCCCACTGCCCCATCGCAGATGG + Intronic
1163729710 19:18941703-18941725 GCCCCCTCCCCAACCTCACTGGG - Intergenic
1163790330 19:19302578-19302600 GACCCCCGCCCCGTCCCACAAGG + Intronic
1163846868 19:19643113-19643135 CCCCCCTGCCCCCTCTCCTAAGG + Intronic
1166803610 19:45472374-45472396 GACCCTTGCCCCAACTCCCATGG + Intronic
1167358272 19:49016974-49016996 GCCTCCTTCCACAGCTCACACGG + Intronic
1167362286 19:49036563-49036585 GCCTCCTTCCACAGCTCACACGG + Exonic
1167423809 19:49419215-49419237 GTCCCCTTCCCCAGCTCCCAGGG + Intergenic
1167762930 19:51460741-51460763 GACCACTGGCCCATCTCATAGGG + Intergenic
1168252616 19:55149096-55149118 GCCTCCTGCCCCCTCCCCCAAGG + Intronic
1168291363 19:55359253-55359275 CCTCCCTGCCCCATCCCAGAAGG - Exonic
1168291386 19:55359343-55359365 GACCCCACCCCCATCTCAGAAGG - Exonic
1168688306 19:58361915-58361937 GCCCCCAGCCGCATCTATCAGGG + Intronic
925034812 2:677057-677079 GGCCCCGGCCCCCTCCCACAGGG + Intronic
925189538 2:1871623-1871645 GCCCCTCCCCTCATCTCACAGGG + Intronic
925990663 2:9251624-9251646 GCTCCCTTCCCCTTCTCCCAAGG - Intronic
926285170 2:11482561-11482583 GCCCCCTGCGCCCTCCCACCCGG - Intergenic
927787298 2:25982569-25982591 GCCCCCTGCCCCACCCCAGTCGG - Intronic
927939232 2:27093285-27093307 CCGTCCTGTCCCATCTCACAGGG - Intronic
928194938 2:29208754-29208776 GACCCCTTCCCTAACTCACAGGG - Intronic
930155137 2:48099106-48099128 ACCCCCTTCCCCCTCACACATGG + Intergenic
931721069 2:65068220-65068242 GCCCCCTACCCCATCCCACCAGG + Intronic
932634233 2:73373881-73373903 GCTCCCTGACCCATCACAGAAGG - Intergenic
932822837 2:74915959-74915981 GCCCACAGCCACATCCCACAGGG + Intergenic
934748271 2:96774146-96774168 TTCCCCTGCCCCCTCCCACAGGG - Intronic
935353918 2:102180402-102180424 GCCACCTGCCCCTTCTCCCCAGG - Intergenic
936092357 2:109509698-109509720 GCACCCTCACCCTTCTCACAAGG + Intergenic
936856316 2:116961840-116961862 GCCCGCTGCCCCATCCTAGATGG - Intergenic
938089522 2:128422178-128422200 GCCCCTTGCCCCATCTCATGGGG + Intergenic
938647664 2:133347980-133348002 GTCTCCTGCCCCATCGCAGAAGG - Intronic
942299945 2:174551683-174551705 GCCCCCTCCTCCAGCTAACAGGG - Intergenic
946422459 2:219572315-219572337 GCCCCGTGCCCCTTCTGCCAGGG - Exonic
946908823 2:224441495-224441517 GCCCCCTGACCCATCTCCTTTGG - Intergenic
947480141 2:230491724-230491746 GGCCCCTCCCCCAACACACAAGG + Intronic
948138865 2:235658548-235658570 GCCCCCAGCACCCTCTCACCCGG - Intronic
948301676 2:236912330-236912352 GCCCCCTGGCCCTGCTCACCTGG + Intergenic
948888859 2:240897179-240897201 GCCCCCTGCCCCACCCCTCCTGG - Intergenic
1169108033 20:3013957-3013979 GCTTCCTGCCCCATCTTACCAGG - Intronic
1169327345 20:4686629-4686651 GCCCCCGGCCCCTCCTCACTGGG - Intronic
1170633278 20:18083341-18083363 GACTCCTGCCCCAGCCCACAAGG + Intergenic
1172100736 20:32483136-32483158 GCCCCCCGCCCCAGCCCACTCGG + Intronic
1173187014 20:40848059-40848081 GGCCCCTGCCCCACCCCACCAGG - Intergenic
1173986147 20:47263088-47263110 CTCCCCTGCCTCATTTCACAGGG + Intronic
1174151281 20:48488394-48488416 GCCCCCTGCCCTATCCCTAAAGG + Intergenic
1181465906 22:23110478-23110500 GCCCACTGCCCTGTCTCTCAGGG + Intronic
1181622194 22:24098709-24098731 GCCACCTGCCCCATCCCACATGG - Intronic
1182131849 22:27859753-27859775 CTCCCCTGCCCCATCTCAGCTGG - Intronic
1182327150 22:29522014-29522036 GCCCCCTTCACCACCTCAAATGG + Intronic
1182367186 22:29787140-29787162 GCCTACTGCCTCATCTCTCAGGG - Intergenic
1182481271 22:30610540-30610562 GCACCTTGCCCAATCTCACTTGG - Intronic
1182584246 22:31334662-31334684 GCCCCCTTTCCCACCTCACAGGG - Intronic
1183538850 22:38418125-38418147 GCCGCCTGCTCCAGCCCACAGGG + Intergenic
1184503197 22:44886084-44886106 GCCTCATGGCCCAGCTCACAGGG + Intronic
1184826659 22:46957148-46957170 GTCCCCTGGCCCATCACACCTGG - Intronic
1184829807 22:46977441-46977463 TCCCCCTGCTCCATCCCACCAGG - Intronic
1184892923 22:47390376-47390398 GCCCCCTGGTCCATCGCCCAAGG - Intergenic
1184895372 22:47403555-47403577 AGCCCCTTCCCCATCTCTCAAGG + Intergenic
1185271939 22:49933860-49933882 GCCCCCTGCCCCGGCTCCCCAGG - Intergenic
949522425 3:4868923-4868945 ACCCCCTGCCCCATCACATCAGG + Intronic
950483396 3:13258816-13258838 GCCCCCCTCCCCACCCCACAGGG + Intergenic
950542543 3:13620980-13621002 GCCCCGCCCCCCATCTCCCAGGG + Intronic
954673995 3:52305646-52305668 GCCCCCAGCCTCTGCTCACACGG - Intergenic
955856606 3:63279032-63279054 CCCCCCTCCCCTATCTCCCAAGG - Intronic
956392416 3:68787607-68787629 GCCCCTTGGCTCATCTCACTAGG + Intronic
960055631 3:113274527-113274549 GCCCCCTGCCCCTTCTCTCCTGG - Exonic
960057999 3:113289660-113289682 GTCCCCTCCCACATCACACAGGG + Exonic
961034210 3:123631096-123631118 GCCCCCAGACCCATCTCATGGGG - Intronic
961043704 3:123694717-123694739 GGCCCCTGCCTCCTCTCCCAGGG + Intronic
961673439 3:128550677-128550699 GCCCCTTCCTCCATCTCACCAGG + Intergenic
962607484 3:137044769-137044791 TCCCCCGGCCCCTGCTCACAGGG - Intergenic
962671643 3:137714550-137714572 GCCCCCTGCTCCATGGCACCCGG - Intergenic
962687766 3:137863636-137863658 GGGAACTGCCCCATCTCACAAGG + Intergenic
963397942 3:144757225-144757247 GCCCCCTGCTCCATGGCACCTGG + Intergenic
966938771 3:184731965-184731987 ACCCCCTGCCCCTTCCCATATGG + Intergenic
968925748 4:3547138-3547160 GCCTCCTTCCCCTTCCCACACGG - Intergenic
969981925 4:11166509-11166531 GACCCCTGCCCCATCTTTAATGG + Intergenic
970004018 4:11393758-11393780 CCCCCATGCCCCATCCCACATGG + Exonic
971342107 4:25780265-25780287 GCCCACTGCCCTCTCTCACTTGG + Intronic
972152404 4:36110072-36110094 GCCCCTTGCCTCACATCACATGG + Intronic
973015517 4:45132934-45132956 TCCCCCTCTCCCATCTCTCAGGG + Intergenic
973039889 4:45457147-45457169 GCCCCCTGCTCCATGGCACCCGG - Intergenic
974757536 4:66230364-66230386 GCCCCCTTCCTCATCTTACAGGG + Intergenic
979425766 4:120563653-120563675 GCCCCCTGCCCTGTCCCACATGG + Intergenic
981645564 4:146994828-146994850 TCCCCCTGCCCTATCACACAGGG + Intergenic
982050883 4:151500491-151500513 GACCCCTGCCCCATGTCACTTGG + Intronic
983010140 4:162537190-162537212 GCCCCCTGTGACCTCTCACAGGG + Intergenic
985684945 5:1277125-1277147 GCCCCCTGCACAATCCCACGAGG + Intronic
985761147 5:1749550-1749572 GCCCCCGGCCACAGCCCACATGG + Intergenic
985875484 5:2591113-2591135 GCTCCCTGCCTCATCTGTCAGGG - Intergenic
985964997 5:3332899-3332921 GCCCTCTGCCCCAGCACTCAGGG + Intergenic
986608703 5:9546394-9546416 GCTCCCTCCCCCGTCTCACTGGG + Intergenic
988599037 5:32622512-32622534 GACCACAGCCCCTTCTCACACGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
994044235 5:95290150-95290172 TCCACCTGACCCATCTCACAAGG + Intergenic
995445006 5:112232835-112232857 TTCCCTTGCCCCACCTCACAGGG + Intronic
997878087 5:137566848-137566870 GGATCCTGCCCCACCTCACAAGG - Intronic
998667068 5:144309514-144309536 GCCCATTTCCCAATCTCACAAGG - Intronic
998878494 5:146623998-146624020 CCCCCCTTCTCCATCTTACAGGG + Intronic
999217051 5:149944165-149944187 GCCCCATGCCCTCTCTCTCATGG + Intronic
999394573 5:151219123-151219145 GCCCCCTGCCCCAACCATCATGG - Intronic
999722020 5:154405431-154405453 GCCCACAGCCCCATCCGACACGG + Intronic
1002048043 5:176553036-176553058 TCCCCCCTCCCCATCTCACAGGG - Intronic
1002113553 5:176938553-176938575 GCACCCTGCTCCCTCTCATAGGG + Intronic
1002165178 5:177339443-177339465 CATCCCTGCCCCAGCTCACATGG - Intronic
1002424851 5:179168865-179168887 GCCTCCTGCCCCAGCTCTCGTGG - Intronic
1005952240 6:30640536-30640558 GCCCCCTGCTCCCTCTCTGAGGG + Exonic
1007195349 6:40055628-40055650 GCCCCCCTCCCCATCTCCCCGGG - Intergenic
1007284233 6:40736357-40736379 GCCCCTGCCCCCATCTCCCAGGG + Intergenic
1008952802 6:57178774-57178796 TCCCCCACCCCCATCCCACAAGG - Intronic
1010254876 6:73746290-73746312 GCCCCCTTCCCCCTCACCCAGGG - Intronic
1011012026 6:82713541-82713563 CCTCCCTGCCCCATCTCAGAAGG + Intergenic
1011488455 6:87867290-87867312 AGTCCCTGTCCCATCTCACAAGG + Intergenic
1013883464 6:114933577-114933599 GCCCCCGCCCCCACCTCACTAGG + Intergenic
1014450295 6:121574071-121574093 GACCACTGCCCCATCTCAGGAGG + Intergenic
1015702917 6:136055797-136055819 GCCCCCTTGCCCATGCCACATGG - Intronic
1016032698 6:139354463-139354485 GCCCCCACCTCCACCTCACAAGG + Intergenic
1018012152 6:159681135-159681157 GGTCCCTGCTCCGTCTCACAGGG - Exonic
1018954874 6:168402698-168402720 GAACCCTGCCCCAGCCCACAGGG + Intergenic
1019512096 7:1422731-1422753 GCCCCCTGCCCCAGCCCTGATGG + Intergenic
1019943642 7:4310208-4310230 AGCCCCTGCCCTAACTCACATGG + Intergenic
1021513752 7:21461227-21461249 GCCCCCTGCTCCATGGCACCCGG - Intronic
1021653568 7:22854073-22854095 GCCCCCCCCCCCACCCCACACGG - Intergenic
1021717776 7:23474628-23474650 GCCCCCAGCCCCAACCCCCAAGG + Intergenic
1021873806 7:25029830-25029852 GTCCCATGTCACATCTCACAGGG - Intergenic
1022033993 7:26516982-26517004 GCCACCAGAGCCATCTCACATGG - Intergenic
1022669935 7:32446423-32446445 CCCCCCTGCCCCATAGCTCATGG - Intergenic
1023590390 7:41775074-41775096 GCCCTCTGCGCCTTCTCACTGGG - Intergenic
1023878454 7:44305610-44305632 CCCACCTCCCCCACCTCACAGGG - Intronic
1023949594 7:44832390-44832412 ATCCCCTGCCCCAACCCACAGGG - Intronic
1026334889 7:69385427-69385449 TCCCCCTGCCCCCTCTCAACAGG - Intergenic
1026665716 7:72337956-72337978 GACCCCTGCCCCAGGTCTCAAGG + Intronic
1026828367 7:73597281-73597303 GCCCCCCGCCCCATCCCCTAGGG - Exonic
1029248416 7:99219029-99219051 GCCCTTGGCCCCACCTCACAGGG + Intergenic
1032433600 7:131882491-131882513 GCTCCCTCCCCCAAGTCACATGG + Intergenic
1033227825 7:139575025-139575047 GGCCCCTCACCCACCTCACAGGG - Intronic
1033235537 7:139635078-139635100 GCCTCCTGCCTCCTCTCACGTGG + Intronic
1034193834 7:149230777-149230799 GCCCCCAGCCCCCACTGACAAGG + Intergenic
1034197164 7:149256878-149256900 GCCTCCTCCCACATCTCATACGG - Intergenic
1034217539 7:149420103-149420125 ACCTCCTGACCCAGCTCACAGGG - Intergenic
1035199442 7:157251519-157251541 GACCCCTTCCTCATCTCAGACGG + Intronic
1035546054 8:483246-483268 GCCCCTCGCCCCTCCTCACAGGG + Intergenic
1036256465 8:7210527-7210549 GCCCCCAGCCCCTGCTAACAGGG - Intergenic
1036308515 8:7669112-7669134 GCCCCCAGCCCCTGCTAACAGGG - Intergenic
1036361019 8:8076965-8076987 GCCCCCAGCCCCTGCTAACAGGG + Intergenic
1036889945 8:12590036-12590058 GCCCCCAGCCCCTGCTAACAGGG - Intergenic
1037558985 8:20055056-20055078 GCCCCCTGCTCCATGGCACCAGG + Intergenic
1037695965 8:21224186-21224208 GCCACCTGCCACATTTAACAGGG - Intergenic
1041377122 8:57216170-57216192 GCCCACTTGCCCAACTCACAAGG + Intergenic
1042046762 8:64661992-64662014 GCCCTCCAGCCCATCTCACAAGG + Intronic
1043043756 8:75295022-75295044 GCTCCCTGCCCTATCTTACAGGG + Intergenic
1043111878 8:76195572-76195594 GCCCACTGCCCAATGTCTCATGG - Intergenic
1043401917 8:79892097-79892119 GGCCCCTGCCCCACATCAGAGGG + Intergenic
1044802866 8:95975064-95975086 GCCCCCTCCTCCATCTCCAAAGG - Intergenic
1044862108 8:96533876-96533898 GCCCCCTGCTCCATGGCACCTGG - Intronic
1044935428 8:97289203-97289225 GCCCCCTCCTCCATCCCACATGG - Intergenic
1046251930 8:111643157-111643179 GCCCCCTGCTCCATGGCACCCGG + Intergenic
1046377263 8:113400342-113400364 TCCCCCTGCCCCATCCCTCGTGG + Intronic
1047250341 8:123177510-123177532 GCCCCCTGCACCTCCTCACCTGG + Intergenic
1048406514 8:134128112-134128134 GTCCCCTACCCAAACTCACATGG + Intergenic
1048654522 8:136521214-136521236 GCCCCCTGCCCCTTTTAAAATGG + Intergenic
1049309334 8:141925026-141925048 GCCCACTGCCCCGGCCCACATGG + Intergenic
1049453944 8:142677598-142677620 GCCCCCCGCCCCAGCTCGCCCGG - Intronic
1049470944 8:142774776-142774798 TCCCCCTGCCCCAGCACACCAGG + Intronic
1049755665 8:144310317-144310339 GCCCCCAGCCCCTCCTCACCGGG + Intronic
1049772379 8:144389454-144389476 GTCCCCTACCCCATCTCACCTGG + Intronic
1049787645 8:144458708-144458730 CCCTCCTGCCCCATCTGACCAGG - Intronic
1049830595 8:144699146-144699168 CCTCACTGCCCCATCTCCCAGGG - Intergenic
1051247967 9:15130820-15130842 GCCCCCTGCCCCGACACACACGG + Intergenic
1052261612 9:26522933-26522955 CTTCTCTGCCCCATCTCACAGGG + Intergenic
1058818631 9:108708772-108708794 GCCCCGTGCCCCAGAGCACACGG + Intergenic
1061059583 9:128243723-128243745 GCCCTCAGCCCCAGGTCACATGG - Intronic
1061376132 9:130225932-130225954 GCCCCCTGCCGGGTCTCCCAGGG + Intronic
1061495837 9:130973740-130973762 GCCTCCTGCCCCAGCTGTCATGG + Intergenic
1061689073 9:132309812-132309834 GCCCCCACCCCCATCACCCATGG - Intronic
1061721253 9:132552786-132552808 GCCAGCTGCCCCAGCTCTCAGGG + Intronic
1061844313 9:133378364-133378386 GCCCCCTGCCCCATAGCACTTGG + Intronic
1062117911 9:134818979-134819001 TCCCCCTGCCTCCTCCCACAGGG + Exonic
1062460906 9:136662198-136662220 GCCCTCAGCCCCACTTCACAGGG - Intronic
1062482582 9:136759385-136759407 GTCCCCTGCCCCCTCACCCAGGG + Intergenic
1062527586 9:136984560-136984582 GCCTGCTGCCCCACCTCACCTGG - Exonic
1062590222 9:137271230-137271252 CCTGCCTGCCACATCTCACAGGG - Intronic
1185554002 X:1006220-1006242 GCCACCTGCCCCATCCTACGTGG + Intergenic
1186425233 X:9459251-9459273 CCCCCCTTCCTCATCTCATATGG + Intergenic
1188893915 X:35643400-35643422 GCCTCTTGCCCCATCATACAGGG - Intergenic
1189897456 X:45670280-45670302 CTCCCCTGCCTCATCTCAAATGG + Intergenic
1189923772 X:45931341-45931363 GCCACGTGACCCATCTCAAAGGG - Intergenic
1191930359 X:66365381-66365403 GCTGCCTGCCCCACCTCCCAGGG + Intergenic
1192330190 X:70169248-70169270 TCCCCTTGCCCTTTCTCACAGGG - Intergenic
1192805669 X:74506398-74506420 GCTCCCTGCCCCATATCACTAGG - Intronic
1195917656 X:109951825-109951847 GCCCCCAACCTCATCTCCCATGG + Intergenic
1199606492 X:149583491-149583513 CCCACCTGCCCCAGCACACATGG - Intronic
1199632630 X:149785877-149785899 CCCACCTGCCCCAGCACACATGG + Intronic