ID: 1138489746

View in Genome Browser
Species Human (GRCh38)
Location 16:57369853-57369875
Sequence TGCATCCCATTTTACATATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138489740_1138489746 22 Left 1138489740 16:57369808-57369830 CCTTAGTTTTATTCACTGTCGTG No data
Right 1138489746 16:57369853-57369875 TGCATCCCATTTTACATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138489746 Original CRISPR TGCATCCCATTTTACATATA GGG Intergenic
No off target data available for this crispr