ID: 1138496984

View in Genome Browser
Species Human (GRCh38)
Location 16:57415014-57415036
Sequence TGTGTGTTGCGGGGACCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138496984_1138496995 28 Left 1138496984 16:57415014-57415036 CCCAGAGGTCCCCGCAACACACA 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1138496995 16:57415065-57415087 GCTCCTCTCCCTGCAGCTCGAGG 0: 1
1: 0
2: 3
3: 44
4: 380
1138496984_1138496996 29 Left 1138496984 16:57415014-57415036 CCCAGAGGTCCCCGCAACACACA 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1138496996 16:57415066-57415088 CTCCTCTCCCTGCAGCTCGAGGG 0: 1
1: 0
2: 0
3: 40
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138496984 Original CRISPR TGTGTGTTGCGGGGACCTCT GGG (reversed) Intronic