ID: 1138496995

View in Genome Browser
Species Human (GRCh38)
Location 16:57415065-57415087
Sequence GCTCCTCTCCCTGCAGCTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 380}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138496987_1138496995 18 Left 1138496987 16:57415024-57415046 CCCGCAACACACACGCAGACACT 0: 1
1: 2
2: 5
3: 116
4: 1471
Right 1138496995 16:57415065-57415087 GCTCCTCTCCCTGCAGCTCGAGG 0: 1
1: 0
2: 3
3: 44
4: 380
1138496985_1138496995 27 Left 1138496985 16:57415015-57415037 CCAGAGGTCCCCGCAACACACAC 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1138496995 16:57415065-57415087 GCTCCTCTCCCTGCAGCTCGAGG 0: 1
1: 0
2: 3
3: 44
4: 380
1138496986_1138496995 19 Left 1138496986 16:57415023-57415045 CCCCGCAACACACACGCAGACAC 0: 1
1: 1
2: 27
3: 507
4: 2397
Right 1138496995 16:57415065-57415087 GCTCCTCTCCCTGCAGCTCGAGG 0: 1
1: 0
2: 3
3: 44
4: 380
1138496983_1138496995 29 Left 1138496983 16:57415013-57415035 CCCCAGAGGTCCCCGCAACACAC 0: 1
1: 0
2: 0
3: 15
4: 180
Right 1138496995 16:57415065-57415087 GCTCCTCTCCCTGCAGCTCGAGG 0: 1
1: 0
2: 3
3: 44
4: 380
1138496988_1138496995 17 Left 1138496988 16:57415025-57415047 CCGCAACACACACGCAGACACTC 0: 1
1: 1
2: 30
3: 799
4: 3488
Right 1138496995 16:57415065-57415087 GCTCCTCTCCCTGCAGCTCGAGG 0: 1
1: 0
2: 3
3: 44
4: 380
1138496984_1138496995 28 Left 1138496984 16:57415014-57415036 CCCAGAGGTCCCCGCAACACACA 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1138496995 16:57415065-57415087 GCTCCTCTCCCTGCAGCTCGAGG 0: 1
1: 0
2: 3
3: 44
4: 380
1138496982_1138496995 30 Left 1138496982 16:57415012-57415034 CCCCCAGAGGTCCCCGCAACACA 0: 1
1: 0
2: 2
3: 12
4: 123
Right 1138496995 16:57415065-57415087 GCTCCTCTCCCTGCAGCTCGAGG 0: 1
1: 0
2: 3
3: 44
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138496995 Original CRISPR GCTCCTCTCCCTGCAGCTCG AGG Exonic