ID: 1138497249

View in Genome Browser
Species Human (GRCh38)
Location 16:57416106-57416128
Sequence CCACTCCGGCCTGTCACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138497244_1138497249 -2 Left 1138497244 16:57416085-57416107 CCCACAGCGCAAGATGCGCTTCC 0: 1
1: 0
2: 8
3: 50
4: 124
Right 1138497249 16:57416106-57416128 CCACTCCGGCCTGTCACTCTGGG 0: 1
1: 0
2: 2
3: 10
4: 145
1138497243_1138497249 -1 Left 1138497243 16:57416084-57416106 CCCCACAGCGCAAGATGCGCTTC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1138497249 16:57416106-57416128 CCACTCCGGCCTGTCACTCTGGG 0: 1
1: 0
2: 2
3: 10
4: 145
1138497242_1138497249 24 Left 1138497242 16:57416059-57416081 CCTCAGTCTGTGTCAGCGTGTCT 0: 1
1: 0
2: 1
3: 14
4: 162
Right 1138497249 16:57416106-57416128 CCACTCCGGCCTGTCACTCTGGG 0: 1
1: 0
2: 2
3: 10
4: 145
1138497245_1138497249 -3 Left 1138497245 16:57416086-57416108 CCACAGCGCAAGATGCGCTTCCA 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1138497249 16:57416106-57416128 CCACTCCGGCCTGTCACTCTGGG 0: 1
1: 0
2: 2
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138497249 Original CRISPR CCACTCCGGCCTGTCACTCT GGG Intergenic
900243861 1:1628977-1628999 CCCCTCCTGCCTGTCCCACTTGG + Intronic
901760700 1:11469358-11469380 CCACTCCTGCCGGTCACTTGGGG - Intergenic
902921896 1:19671226-19671248 CCCCTCCAGCCTTTCACTTTAGG - Intronic
903027811 1:20442088-20442110 TCACCCCGGGCTCTCACTCTTGG - Intergenic
903656107 1:24949753-24949775 CACCTCTGGCCTGCCACTCTGGG + Intronic
904508742 1:30983206-30983228 CCACTCCTGGCTGCCCCTCTTGG - Intronic
907311177 1:53540006-53540028 CCAGTCCTCCTTGTCACTCTAGG + Intronic
909901511 1:81142295-81142317 CCACTCAGGCCTGTTAGCCTGGG - Intergenic
911057567 1:93721522-93721544 CCACTGGGGCCTGTATCTCTAGG - Intronic
911845552 1:102747208-102747230 CCTTTCCAGCCTGTTACTCTTGG + Intergenic
912351582 1:109019031-109019053 CCACTCCAGCCTGGCAGCCTAGG + Intronic
918336831 1:183524154-183524176 TCACTGCGGCCTGGAACTCTGGG + Intronic
919143287 1:193601054-193601076 CCACTCTGGCTTGACAGTCTTGG - Intergenic
921352060 1:214245951-214245973 CCTCTCCGACCTGTCAGTGTGGG + Intergenic
922301663 1:224306791-224306813 CCACTCCACCATGTCAGTCTGGG + Intronic
922665540 1:227465673-227465695 CCACTCGGGGCTGGCACTTTGGG - Intergenic
924595118 1:245438515-245438537 CCACCCAGACCTTTCACTCTAGG + Intronic
1067081451 10:43214870-43214892 CCTCTCCGGGCTGTCTCCCTGGG - Intronic
1071069183 10:81671401-81671423 GCACTCCAGCCTGCCACCCTGGG + Intergenic
1074104336 10:110377097-110377119 CCATTCCTGGCTGTCCCTCTTGG + Intergenic
1076171214 10:128321684-128321706 CCACCCTGGCCTCTCAATCTTGG + Intergenic
1076307365 10:129474646-129474668 CCACCCCAGCCTGTCCCTGTTGG + Intronic
1076877221 10:133221849-133221871 CCACTCACGCCTGTAACCCTAGG + Intronic
1076877232 10:133221891-133221913 CCACTCACGCCTGTAACCCTAGG + Intronic
1076877243 10:133221933-133221955 CCACTCACGCCTGTAACCCTAGG + Intronic
1076877255 10:133221975-133221997 CCACTCACGCCTGTAACCCTAGG + Intronic
1077285755 11:1764470-1764492 CCGCTCCGCCCTCTCCCTCTGGG + Intergenic
1077523273 11:3048896-3048918 CCACTCAGGTGTGTCACTCAAGG + Intronic
1078541554 11:12217472-12217494 CCACTGCTGACTGTCAGTCTGGG + Intronic
1080639653 11:34151428-34151450 CCACTGGGGACTGTGACTCTTGG - Exonic
1081508738 11:43745933-43745955 TCACTACAGCCTCTCACTCTTGG - Intronic
1081821361 11:45998895-45998917 TCACTGCGGCCTCTGACTCTTGG + Intronic
1081939821 11:46931228-46931250 CCACTGCGCCCGGTCAGTCTGGG + Intergenic
1083147853 11:60772232-60772254 CCTCCCCGGCCTCTCCCTCTCGG - Intronic
1084632109 11:70359859-70359881 CCACTCCACCCTGGCCCTCTGGG - Intronic
1085641346 11:78195056-78195078 CCACACCGGCCTGTCACCCTTGG - Intronic
1088860598 11:113795478-113795500 CCACTCTGGCTTTTCACTCTTGG - Intergenic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1092793980 12:12092565-12092587 CCTCCCCTGCCTGTCCCTCTCGG - Intronic
1096703896 12:53406354-53406376 CCACTGCGCCCAGCCACTCTTGG + Intronic
1101782845 12:107850735-107850757 CCACTCTGTCTTGCCACTCTTGG + Intergenic
1102146388 12:110658121-110658143 CCACTCTGTCCTGTCATTCATGG + Intronic
1102346083 12:112162302-112162324 CCACTGCGGCCCGTCCCTCCAGG - Exonic
1102629522 12:114265513-114265535 CCAGTCCAGCCTCTTACTCTGGG + Intergenic
1104219394 12:126767349-126767371 CCACTCCGGCCCATGACTCTGGG - Intergenic
1105768577 13:23585776-23585798 CCACTCCCCACTGTCACACTGGG - Intronic
1106405523 13:29469730-29469752 TCACTGCAGCCTGTAACTCTTGG - Intronic
1110179460 13:72597988-72598010 CCACTGCTGCCTGTTTCTCTAGG - Intergenic
1111213279 13:85108749-85108771 CCACTCCAGCCTGCAGCTCTGGG + Intergenic
1112184215 13:97112587-97112609 CCACTCCAGCCTTCCACCCTTGG - Intergenic
1113525953 13:110976714-110976736 CCACTCATGCCTGAAACTCTAGG - Intergenic
1113580570 13:111425794-111425816 CCTCTCCCGTCTCTCACTCTTGG + Intergenic
1114208442 14:20595606-20595628 CCACGCTGGTCTGTAACTCTTGG + Intronic
1115398204 14:32933197-32933219 CCAATCCGCCCTGCCCCTCTGGG + Intergenic
1116514622 14:45789889-45789911 CCACTCTGTCTTGCCACTCTTGG + Intergenic
1118850243 14:69577520-69577542 GCACTCCAGCCTCTCACTCTAGG + Intergenic
1121451285 14:94009770-94009792 CCACTCCAGTCTGACATTCTAGG + Intergenic
1123768694 15:23507774-23507796 CCACTCTGTCTTGCCACTCTTGG - Intergenic
1127968881 15:63943923-63943945 CCACTCTGGCCTGGCAACCTGGG + Intronic
1128054923 15:64692302-64692324 CCTCTCCAGCCTGTAACTGTGGG - Intronic
1129786819 15:78315224-78315246 CCACTCTGCCCTGGCCCTCTTGG - Intergenic
1131471635 15:92702719-92702741 CCACTCCAGCCGGACAGTCTAGG - Intronic
1137512933 16:49117107-49117129 TCACCCCGGCCTGGCACTCTGGG + Intergenic
1137674024 16:50294949-50294971 CCCCACTGGCCTGTCACTCTGGG - Intronic
1138497249 16:57416106-57416128 CCACTCCGGCCTGTCACTCTGGG + Intergenic
1139068594 16:63351248-63351270 CCACTCCAGGCTATCCCTCTAGG - Intergenic
1141662134 16:85447075-85447097 CTGCTCGGGCCTCTCACTCTGGG + Intergenic
1142660438 17:1425467-1425489 TCACTGCAGCCTGTAACTCTTGG + Intronic
1148142763 17:45340025-45340047 CCTCTCCTGCCTGTCCCTCTTGG + Intergenic
1148506959 17:48135094-48135116 CAGCTCAGGCCTGTCACTCAAGG - Intronic
1161378694 19:3953225-3953247 CCAGTCTGGCCTGCAACTCTCGG + Intergenic
1162667754 19:12229462-12229484 CCACTCTGTCTTGCCACTCTTGG - Intronic
1162914380 19:13866083-13866105 CCCCTCCGGCCTGTCATTACCGG + Intronic
1163143949 19:15368500-15368522 CTACTCCGGGCTCTCACTCCAGG - Intronic
1165791730 19:38496701-38496723 CCACTCTGGGCTGTCACTATTGG - Intronic
1165872193 19:38980890-38980912 CCACTCTGGCCTGTAGCTCCAGG - Intergenic
1166180958 19:41108397-41108419 TCACTGCGGCCTCTCCCTCTTGG - Intergenic
926300549 2:11599105-11599127 CCACCCCACCCTGTGACTCTGGG - Intronic
933708792 2:85310168-85310190 CCGGTCCCGCCTGCCACTCTGGG - Exonic
935228661 2:101077280-101077302 GCACTCCAGCCTGGCACTTTGGG - Intronic
940142799 2:150512955-150512977 CCACTGCACTCTGTCACTCTGGG - Intronic
943381775 2:187158574-187158596 GCACTCCCTTCTGTCACTCTAGG + Intergenic
947914598 2:233823141-233823163 CCACGCCAACCTGTGACTCTAGG + Intronic
1172661950 20:36574152-36574174 CCACCCCCAGCTGTCACTCTCGG - Intronic
1173785933 20:45792630-45792652 TCACTGCGGCCTGTGACACTGGG - Intronic
1175737033 20:61394303-61394325 CCGCCCCTGCCTGTCCCTCTCGG + Intronic
1176411268 21:6450739-6450761 GCTCTCCTGCCTGTCACACTGGG + Intergenic
1176411281 21:6450788-6450810 GCTCTCCTGCCTGTCACACTGGG + Intergenic
1176411294 21:6450838-6450860 GCTCTCCTGCCTGTCACACTGGG + Intergenic
1179378996 21:40881093-40881115 TCACTGCAGCCTCTCACTCTTGG - Intergenic
1179686761 21:43059061-43059083 GCTCTCCTGCCTGTCACACTGGG + Intronic
1179686774 21:43059110-43059132 GCTCTCCTGCCTGTCACACTGGG + Intronic
1179686787 21:43059160-43059182 GCTCTCCTGCCTGTCACACTGGG + Intronic
1180171585 21:46061767-46061789 CCACTCTGACCCGTGACTCTGGG + Intergenic
1180855299 22:19041489-19041511 CCACACCAACCTGTCCCTCTGGG + Intronic
1181271510 22:21661363-21661385 CCACTCCTGCCTCTCCCTGTGGG + Intronic
1183183892 22:36280654-36280676 CCACCCTGCCCTGTCACCCTGGG - Intergenic
1183714691 22:39526867-39526889 CCACTCCTGCCTGGCCCCCTTGG + Intergenic
1184870327 22:47233691-47233713 CCACTCCAGCCTGTGGCTCTGGG - Intergenic
949864496 3:8536270-8536292 CCTTTCCGGCCTGTCACCATGGG - Intronic
950392214 3:12705574-12705596 TCACCCCGGCCTTTCGCTCTGGG - Intergenic
951564682 3:24001616-24001638 CCACTAAGGCGTGACACTCTGGG + Intergenic
954146912 3:48639015-48639037 CCACTCCCACCAGTCCCTCTCGG + Intronic
954432416 3:50477917-50477939 CCACTCAGGCCTGTGACTAAGGG + Intronic
958110229 3:89132813-89132835 CCACTGCAGCCTGGAACTCTTGG - Intronic
967896022 3:194396893-194396915 GCACGCCGGCCTGCCGCTCTGGG - Exonic
969107735 4:4820538-4820560 CCACTCTGGCCTGGCACGCCTGG - Intergenic
971944368 4:33255025-33255047 CCACTCCATCTTGCCACTCTTGG - Intergenic
975153524 4:71045652-71045674 CCACTCCAGCCTGTCAGCTTTGG + Intergenic
982494816 4:156077572-156077594 CCACTCCGGCCTGTGGCTCCTGG + Intergenic
983448953 4:167887601-167887623 CCATTCTGGCCTGTGGCTCTGGG - Intergenic
984064645 4:175033080-175033102 CCACTCTGGCCTGCAGCTCTTGG + Intergenic
984985771 4:185328433-185328455 CCACTCTGTCTTGCCACTCTTGG - Intronic
995856480 5:116598025-116598047 CCACTCCAGCCTGGCAGCCTGGG - Intergenic
1000610158 5:163365177-163365199 CCACTCCGGCCTGTGGCTCTGGG - Intergenic
1003034839 6:2633462-2633484 CCACTCCTCGCTGCCACTCTGGG + Intronic
1004510932 6:16284259-16284281 CCAGTGAGGCCTGTCACTCCAGG - Intronic
1005506847 6:26476722-26476744 CCACTGCTGCCTTTCACTCAAGG + Intergenic
1006309680 6:33249035-33249057 CCACTCCCAGGTGTCACTCTTGG - Intergenic
1012625485 6:101399686-101399708 CCACTCCCGCCTGTCTCCCCCGG + Intronic
1013650929 6:112193686-112193708 CCACACAGGCCTGGCATTCTGGG + Intronic
1014391983 6:120874227-120874249 CCACTCTGGCCTGTGGCGCTTGG - Intergenic
1017967178 6:159276725-159276747 CCACTCCTTCCTGCCTCTCTTGG + Intergenic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1021878734 7:25073166-25073188 CCACTTCCTACTGTCACTCTTGG + Intergenic
1023184268 7:37516614-37516636 CCTCTCACTCCTGTCACTCTGGG + Intergenic
1023719406 7:43077574-43077596 CCACCCCGCCCCGTCACTCCCGG - Intergenic
1027549260 7:79570611-79570633 CCACTCAGGCCAGTCTCTCTGGG - Intergenic
1029608669 7:101615028-101615050 CCACTCCTGCCTGCAATTCTTGG + Intronic
1034446311 7:151115804-151115826 CCCCTCCGGCCTGTCCTCCTCGG - Intronic
1035315528 7:157995441-157995463 CCAGGCCTGCCTGTCACTCAGGG + Intronic
1036026612 8:4915884-4915906 CCACTCCTGCCTGGCACTTATGG - Intronic
1038231572 8:25705424-25705446 CCACTGCATCTTGTCACTCTTGG - Intergenic
1039419149 8:37421136-37421158 GCTCTCCAGCCTGTCAATCTAGG - Intergenic
1046174076 8:110552117-110552139 CCACTCAGGAATGCCACTCTTGG + Intergenic
1049143993 8:140984118-140984140 CCACTCCAGCCTGGCAGCCTGGG + Intronic
1054782256 9:69175950-69175972 CTACTCCTGCCAGTCACTGTGGG + Intronic
1056787967 9:89606070-89606092 CCCCGCCGGGCTGTCACTCGGGG - Exonic
1056839922 9:89990335-89990357 GCCCTCCTTCCTGTCACTCTTGG + Intergenic
1057380073 9:94559559-94559581 CCATGCCGGCTTGTCTCTCTGGG + Intronic
1057600800 9:96455415-96455437 GCACTCCAGCCTGGCAGTCTGGG + Intronic
1059657297 9:116368464-116368486 GCACACCGGCCTGGCACTGTGGG - Intronic
1060598544 9:124862550-124862572 GCACTCCAGCCTGGCACCCTGGG - Intronic
1186518112 X:10182124-10182146 CCACTCCACCCTCTCACTATTGG + Intronic
1187680038 X:21758640-21758662 CCTCACCAGCCTGTCAATCTTGG - Intergenic
1188176420 X:26996133-26996155 TCACTGCGGCCTCCCACTCTTGG - Intergenic
1192268605 X:69557485-69557507 TCACTCCAGCCTGTTTCTCTTGG - Intergenic
1194512349 X:94811901-94811923 CCACTCCCCCCTTCCACTCTAGG - Intergenic
1195337916 X:103875335-103875357 CCACTCTGTCTTGCCACTCTTGG - Intergenic
1196057836 X:111375089-111375111 CCACTCCTGCCTTTAACCCTTGG - Intronic
1197097738 X:122615291-122615313 CCACTCTGCCTTGCCACTCTTGG + Intergenic
1198855503 X:141011066-141011088 CCACTCTGTCTTGCCACTCTTGG + Intergenic
1198876631 X:141235127-141235149 CCACTCTGTCTTGCCACTCTTGG - Intergenic
1198907192 X:141576302-141576324 CCACTCTGTCTTGCCACTCTTGG - Intergenic
1198909602 X:141598100-141598122 CCACTCTGTCTTGCCACTCTTGG + Intronic
1198917485 X:141690046-141690068 CCACTCTGTCTTGCCACTCTTGG - Intronic
1201630175 Y:16063097-16063119 CCACTCTGTCTTGCCACTCTTGG - Intergenic
1201636604 Y:16129279-16129301 CCACTCTATCTTGTCACTCTTGG + Intergenic