ID: 1138497250

View in Genome Browser
Species Human (GRCh38)
Location 16:57416109-57416131
Sequence CTCCGGCCTGTCACTCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138497244_1138497250 1 Left 1138497244 16:57416085-57416107 CCCACAGCGCAAGATGCGCTTCC 0: 1
1: 0
2: 8
3: 50
4: 124
Right 1138497250 16:57416109-57416131 CTCCGGCCTGTCACTCTGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 168
1138497243_1138497250 2 Left 1138497243 16:57416084-57416106 CCCCACAGCGCAAGATGCGCTTC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1138497250 16:57416109-57416131 CTCCGGCCTGTCACTCTGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 168
1138497245_1138497250 0 Left 1138497245 16:57416086-57416108 CCACAGCGCAAGATGCGCTTCCA 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1138497250 16:57416109-57416131 CTCCGGCCTGTCACTCTGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 168
1138497242_1138497250 27 Left 1138497242 16:57416059-57416081 CCTCAGTCTGTGTCAGCGTGTCT 0: 1
1: 0
2: 1
3: 14
4: 162
Right 1138497250 16:57416109-57416131 CTCCGGCCTGTCACTCTGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138497250 Original CRISPR CTCCGGCCTGTCACTCTGGG AGG Intergenic
901711198 1:11116751-11116773 CTCATGCCTGTCATCCTGGGAGG - Intronic
904616813 1:31754408-31754430 CCACTGCCTGTCACTCTGTGGGG - Intronic
905019303 1:34797487-34797509 CTCTGGCCTCTCACCCTGGCTGG - Intronic
906377200 1:45304819-45304841 CTCTGACCTGGCACTCTGTGGGG - Intronic
906543700 1:46607049-46607071 CTCCAGCCCCTTACTCTGGGTGG - Intronic
907146971 1:52243727-52243749 CTCAGCTCTGTCACTCTGGCTGG - Intronic
907523308 1:55039295-55039317 CTCCCGCCTCTCACCCTGCGTGG - Intergenic
914827642 1:151146812-151146834 TCCCGGCCTGGCCCTCTGGGTGG - Intergenic
915351765 1:155231449-155231471 CTTCTGCCTGTCAGTCAGGGAGG + Intergenic
919289709 1:195613958-195613980 CGCAGGCCTGTAACTTTGGGAGG - Intergenic
919797930 1:201332414-201332436 CCCAGGCCTGTCACTTTGAGAGG + Exonic
920455100 1:206095019-206095041 CACTGGCCTGTTACACTGGGGGG + Intronic
922287510 1:224183144-224183166 CGCCCGCCTGCCTCTCTGGGTGG - Intronic
1065322273 10:24520812-24520834 CTCCAGCCTGGCAGCCTGGGTGG + Intronic
1070371017 10:75781975-75781997 CTCCTGCCTCTCCCTCTGTGGGG + Intronic
1073492087 10:103859421-103859443 CTCCTGCCTGTCCCTGTGGCAGG - Intergenic
1075259524 10:120950254-120950276 CTCCGGCTTGTCCCTCTGCGCGG + Intergenic
1077037428 11:502224-502246 CTCCGGCCTGTGAAACTGTGAGG - Exonic
1077326367 11:1965749-1965771 CTCCAGCCTGTGGCTCGGGGTGG - Intronic
1079295915 11:19233872-19233894 CTCAGGCCTGTAATTTTGGGAGG + Intronic
1080463459 11:32475628-32475650 CTCATGCCTGTAACTTTGGGAGG + Intergenic
1085091126 11:73714709-73714731 CTCACGCCTGGCACTTTGGGAGG + Intronic
1086105903 11:83146441-83146463 CTCACGCCTGTAACTTTGGGAGG - Intergenic
1087200838 11:95342789-95342811 CTCCAGCCTGACACCTTGGGAGG - Intergenic
1087836252 11:102878240-102878262 CTACGGCCTGACACACTGAGGGG - Intergenic
1088807558 11:113366103-113366125 GTCAGTCCTATCACTCTGGGTGG - Intronic
1090976165 11:131682536-131682558 CTCAGGACTGTGACCCTGGGTGG + Intronic
1202809348 11_KI270721v1_random:20928-20950 CTCCAGCCTGTGGCTCGGGGTGG - Intergenic
1091622722 12:2101520-2101542 CACAGGCCTGACACTCAGGGAGG - Intronic
1091828486 12:3532953-3532975 CTCCACCCTCCCACTCTGGGAGG - Intronic
1093450796 12:19311167-19311189 CTCATGCCTGTCACTTTGGAAGG + Intronic
1093915867 12:24801913-24801935 CTCCTGCCACTCACTTTGGGAGG - Intergenic
1094025886 12:25959096-25959118 CCCCGGCCGGCCCCTCTGGGCGG + Exonic
1094338884 12:29388997-29389019 ATAAGGCCTGTCACTCTGGAAGG - Intergenic
1097145182 12:56935043-56935065 CTCAGGCCTGACACCCTGTGGGG + Intergenic
1099734055 12:86543869-86543891 CTGGGGCCTGACAGTCTGGGAGG + Intronic
1100345895 12:93730743-93730765 CTTTGCCCTGTCACTCTGGCTGG + Intronic
1101732115 12:107435376-107435398 CTCCCACCTGTCACTCTCTGTGG + Intronic
1102399569 12:112616760-112616782 CTCCTGTCCATCACTCTGGGTGG - Intronic
1106124230 13:26886966-26886988 CTCCTGCCTGGCACCCTTGGTGG - Intergenic
1106268072 13:28127600-28127622 CACAGGCCTGGCACTTTGGGAGG + Intergenic
1106295815 13:28412824-28412846 CTCTGGCCTGTAATCCTGGGAGG - Intronic
1106776656 13:33016274-33016296 CTCCGCCCTGGCACTGGGGGCGG - Intergenic
1107749726 13:43552066-43552088 TTTCGCCCTGTCACTCTGAGAGG + Intronic
1107845180 13:44505295-44505317 CTCCTGCCTGTAACCTTGGGAGG + Intronic
1108612784 13:52100516-52100538 CTCAGTCCTGGCACTTTGGGAGG - Intronic
1115810876 14:37105922-37105944 CTCCAGCCTGTCCCTCTGTTCGG - Intronic
1119124579 14:72113704-72113726 CTCAGGCCTGTCACTCTCCTTGG + Intronic
1121426264 14:93854354-93854376 CTATGGCCTGTCACTGTGGAGGG - Intergenic
1121802463 14:96786060-96786082 CTCCGGCCTCTCTCTTTGGATGG - Intergenic
1121817425 14:96939462-96939484 CACCTGCCTGTCTCTCAGGGTGG - Intergenic
1122543720 14:102511036-102511058 CCCCAGCCAGTCAGTCTGGGTGG + Intergenic
1123105621 14:105839833-105839855 CTGGGGGCTGTCACTCTGGGTGG + Intergenic
1127070684 15:55285908-55285930 CTCCGGTCTGCCACTGTGGGAGG + Intronic
1127334863 15:57974175-57974197 CTCATGCCTGTAACTTTGGGAGG + Intronic
1129318821 15:74762589-74762611 CGGCGGCCTGTCCCACTGGGAGG - Intergenic
1131048311 15:89330147-89330169 CTCCTGCCAGTCTCTCTGGGTGG + Exonic
1131269716 15:90939636-90939658 CTCCAGCTCCTCACTCTGGGAGG - Intronic
1132664796 16:1076426-1076448 ATCCGTCCTGTCTCTCTGGCTGG + Intergenic
1132733665 16:1375293-1375315 CTCCCGCCTGCCGCTCTGGGTGG - Intronic
1138424372 16:56920962-56920984 CTGGGGCCTGTCAGTGTGGGAGG + Intergenic
1138497250 16:57416109-57416131 CTCCGGCCTGTCACTCTGGGAGG + Intergenic
1139055681 16:63180849-63180871 CTCAGGCATTTCACTTTGGGAGG + Intergenic
1139477386 16:67209544-67209566 CTCAGCGCTGTCCCTCTGGGTGG - Intronic
1141552261 16:84813911-84813933 TTCCCTCCTGTTACTCTGGGAGG - Intergenic
1142034255 16:87854028-87854050 ATCAGGGCTGTCACTGTGGGTGG + Intronic
1144438196 17:15259906-15259928 CTCCAGCCTGTCACCCGGGCTGG - Intronic
1147253015 17:39165016-39165038 CCCCTGCCTGTCAGTCTGGTGGG + Intronic
1147279851 17:39350232-39350254 CTCATGCCTGTAACTTTGGGAGG + Intronic
1149932610 17:60770671-60770693 CTCATGCCTGTCACTTTGGGAGG - Intronic
1152133606 17:78491640-78491662 CCCTGGCCTCTCTCTCTGGGAGG + Intronic
1152798645 17:82321092-82321114 CTCCGGCCCGACCCTCAGGGCGG + Exonic
1153371345 18:4319934-4319956 CTCAGCCCTCCCACTCTGGGAGG + Intronic
1153801108 18:8669947-8669969 CTCATGCCTGTAACTTTGGGAGG + Intergenic
1157244515 18:46041502-46041524 CTCACGCCTGGCACTTTGGGAGG - Intronic
1157911963 18:51624824-51624846 GTCCAGCTTGTCACTCTGGTAGG + Intergenic
1160151347 18:76396791-76396813 CTCCGGCCTCTCACTCTCAGTGG - Intronic
1160218159 18:76952467-76952489 CTCTGGCCTGTGCTTCTGGGAGG + Intronic
1160366264 18:78328581-78328603 CTCCAGCCTGCCAGCCTGGGTGG - Intergenic
1160436984 18:78859278-78859300 CTCCTGCCTGTGACTCGGGCTGG + Intergenic
1163432717 19:17277847-17277869 CTCCGCCCTGTCACCCAGGCTGG - Intronic
1165723455 19:38095970-38095992 CTTTGCCCTGTCAATCTGGGTGG - Intronic
1166716537 19:44972123-44972145 CTCATGCCTGTAACTTTGGGAGG - Intronic
1167569388 19:50277347-50277369 CTCTTGCCTGTAACTTTGGGAGG + Intronic
927472297 2:23385500-23385522 CTCCTGCCTGTCAGCCTGTGCGG - Exonic
929468714 2:42169716-42169738 CTCCCGCCTGCCCCTCGGGGTGG + Intronic
930217335 2:48710107-48710129 CCCCTGCATCTCACTCTGGGTGG + Intronic
932340162 2:70958529-70958551 TTCCTGCCTGTCTCTCTGGTGGG + Intronic
933613332 2:84459300-84459322 CTCCGGCCTCTGCCCCTGGGAGG - Exonic
933903574 2:86867089-86867111 CTCATGCCTGTAACTTTGGGAGG + Intergenic
934034579 2:88078165-88078187 ATCCTGCCTGTCACTCAGAGAGG - Intronic
935228660 2:101077277-101077299 CTCCAGCCTGGCACTTTGGGAGG - Intronic
936252350 2:110876440-110876462 CTGAGGCCCGTCCCTCTGGGAGG + Intronic
937349175 2:121149568-121149590 CTGAGGCCGGTCACTCCGGGAGG + Intergenic
938841200 2:135165913-135165935 CTCACGCCTGTAACTTTGGGAGG + Intronic
938990411 2:136622734-136622756 CTGCATGCTGTCACTCTGGGGGG + Intergenic
940495645 2:154424636-154424658 CTCAGCCCTGTCACTCTTTGAGG + Intronic
942179766 2:173369392-173369414 CTCTTGCCTGTGACTTTGGGAGG - Intergenic
948366053 2:237455490-237455512 CTCCAGCCTGTCACTGAGTGAGG - Intergenic
948459126 2:238120688-238120710 CTCCGTCTTCTCCCTCTGGGAGG + Intronic
1170763604 20:19272801-19272823 ATCCAGGCTGTCACTTTGGGAGG + Intronic
1171412528 20:24956777-24956799 CCCCAGCCTGGCCCTCTGGGCGG - Intronic
1172130553 20:32652050-32652072 CTCACACCTGTCACTTTGGGAGG + Intergenic
1173435981 20:43032665-43032687 CTCAGGCCTGACGCTCTGCGGGG - Intronic
1173557099 20:43973967-43973989 CCCCAGCCTGGCCCTCTGGGGGG + Intronic
1174424372 20:50421684-50421706 CTCCATCCTGTCATTCTGGAAGG - Intergenic
1174430390 20:50464286-50464308 CTCCGCCCTGTCACCCTTGCGGG - Intergenic
1174892809 20:54415439-54415461 TCCCTGCCTCTCACTCTGGGAGG - Intergenic
1179014489 21:37583967-37583989 CTCATGCCTGGCACTTTGGGAGG - Intergenic
1179178140 21:39023317-39023339 CTGCAGCCTGACACTGTGGGCGG - Intergenic
1180699926 22:17775705-17775727 CTCGGGCTGGGCACTCTGGGGGG + Intergenic
1181671912 22:24429553-24429575 GACCTTCCTGTCACTCTGGGAGG + Intronic
1182299012 22:29327649-29327671 CTCGGGCCTGACACACTGGCTGG + Intergenic
1182507765 22:30797310-30797332 CTCCGCCCTGTCACCCAGGCTGG + Intronic
1183748287 22:39704724-39704746 CTCCAGCCAGTCACTCTTTGGGG - Intergenic
1184724589 22:46336098-46336120 CGCCGGCTTCTCACTGTGGGTGG - Intronic
949891111 3:8734298-8734320 CTCCTGGCTCTCACCCTGGGAGG + Intronic
950532003 3:13557677-13557699 CTCTGACCTGTCACTGTGGATGG + Intronic
951508657 3:23477932-23477954 CTCTCTCCTGTCACTCTGTGAGG + Intronic
954123740 3:48516710-48516732 CTCTGCCCTGACACACTGGGAGG + Intergenic
954226495 3:49185003-49185025 CTCAGGCCTGTAACTTTGGGGGG + Intronic
955285094 3:57632439-57632461 CTCAGGCCTGCCACTTTGGGAGG - Intronic
956639872 3:71405513-71405535 CTCCTGGCTGTCTGTCTGGGTGG - Intronic
956680539 3:71775473-71775495 CTCTGGCCTGTCACATGGGGTGG + Intronic
957914081 3:86663520-86663542 CTGCGGCCTGTCAGTGGGGGTGG + Intergenic
958728281 3:97932675-97932697 CTCTGTCCTGTCAGTGTGGGAGG + Intronic
960905920 3:122601278-122601300 CTCATGCCTGTAACTTTGGGAGG - Intronic
961130156 3:124458669-124458691 CTCATGCCTGTAACTTTGGGGGG + Intronic
961830176 3:129619258-129619280 CTCCTTCCTGCCACCCTGGGTGG - Intergenic
962822102 3:139059269-139059291 CTGGGGCCTGTCAGTCAGGGGGG - Intronic
965592841 3:170378797-170378819 CTCATGCCTGTAACTTTGGGAGG - Intronic
967746850 3:193065966-193065988 CTCATGCCTGTAACTTTGGGAGG + Intergenic
967777830 3:193402712-193402734 CTCCGGCATGTCAGAGTGGGAGG + Exonic
969452165 4:7280537-7280559 GTACTGCCTGTCATTCTGGGAGG + Intronic
969476909 4:7427077-7427099 ATCCAGGCTGTCACCCTGGGAGG - Intronic
970436138 4:16037259-16037281 CGTCGGCCTGTATCTCTGGGGGG - Intronic
972562824 4:40243730-40243752 CTCCCGCTGGTCAGTCTGGGTGG - Exonic
979835324 4:125359874-125359896 CTCCAGCCTGGATCTCTGGGAGG + Intronic
984972269 4:185202290-185202312 CTCATGCCTGTAACTTTGGGAGG + Intronic
985982414 5:3481880-3481902 ATCCAGCCTGTCACTCAGGCTGG + Intergenic
987083756 5:14449408-14449430 CTAGGGCTTCTCACTCTGGGTGG + Intronic
991945125 5:71892199-71892221 CTCAGGCCTGTGACTCTCAGTGG + Intergenic
996619504 5:125482905-125482927 CTCCCGCCTGTCACCCAGGCTGG - Intergenic
999765605 5:154738331-154738353 CTCATGCCTGTAACTTTGGGAGG + Intronic
1001021551 5:168187278-168187300 CTCCAGCCTGTCACTCTTTCCGG - Intronic
1002538475 5:179891279-179891301 CTCTGCCCTGTCTCACTGGGGGG - Intronic
1007726511 6:43919741-43919763 CTTCGCCCTGTAACACTGGGGGG - Intergenic
1013318803 6:108966979-108967001 CTCCTGCCTGCCTCTCTGGGAGG - Intronic
1013650930 6:112193689-112193711 CACAGGCCTGGCATTCTGGGAGG + Intronic
1013947111 6:115734974-115734996 CTCTGTCCTGTCACCCTGTGAGG + Intergenic
1017683881 6:156892152-156892174 CTCACGCCTGTCACTTTGGGAGG - Intronic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1020956549 7:14746080-14746102 CTCATGCCTGGCACTTTGGGAGG + Intronic
1021079339 7:16344898-16344920 CTCTGTCCTGTCCTTCTGGGTGG - Intronic
1022130694 7:27401833-27401855 CTTCCTCCTGTCACTCTGTGAGG + Intergenic
1022440244 7:30427175-30427197 CTCCAGACTGTGGCTCTGGGAGG - Intronic
1025244420 7:57305508-57305530 CTCCGCCCTGTCACCCTTGAGGG + Intergenic
1029435642 7:100562625-100562647 CTCCAGTCTGTCACGATGGGCGG + Exonic
1029821545 7:103151701-103151723 CTCAAGCCTATCACTTTGGGAGG - Intergenic
1030492077 7:110249830-110249852 CTACTGCTTGTCACTTTGGGGGG + Intergenic
1031406886 7:121396433-121396455 CTCCGGCCCTTCCCTCTGGCCGG - Intergenic
1032566683 7:132954106-132954128 CTCCTGCCTGTCCCTCTGCCTGG - Intronic
1033337002 7:140462283-140462305 CTCATGCCTATCACTTTGGGAGG - Intronic
1034738850 7:153454620-153454642 CTCTGGACTGTCCCTCTGGAAGG - Intergenic
1035650119 8:1257604-1257626 CCCCGGGCTGTCACGCTGGATGG + Intergenic
1035684134 8:1510544-1510566 CTCCCACCTGTCACTCTGCGTGG + Intronic
1035772923 8:2163697-2163719 CTCACGCCTGGCACTTTGGGAGG - Intronic
1036162685 8:6404496-6404518 CTCACGCCTGCCACTTTGGGAGG - Intergenic
1048408846 8:134150801-134150823 CTCATGCCTGGCACCCTGGGGGG + Intergenic
1048833474 8:138497410-138497432 CTCGCGCCGGTCAGTCTGGGAGG - Intergenic
1049283765 8:141763578-141763600 CTCAGGCCTGTGATTCTGGGAGG - Intergenic
1049423623 8:142527548-142527570 CTGGGGTCTGTCACTCTGGGTGG + Intronic
1054144211 9:61550338-61550360 CTCGGGGCTGGCACTCTCGGTGG + Intergenic
1054649098 9:67611960-67611982 CTCGGGGCTGGCACTCTCGGTGG + Intergenic
1056787964 9:89606067-89606089 CGCCGGGCTGTCACTCGGGGAGG - Exonic
1057371713 9:94479907-94479929 CTGCGTCCTCTCACTCTGTGTGG + Intergenic
1059451200 9:114372411-114372433 CCCCCGCCTGTCACTGTGGCTGG + Intronic
1060238556 9:121884159-121884181 CTTAGGGCTGTCCCTCTGGGAGG - Intronic
1060951553 9:127607035-127607057 ATCCGACCTCTCACTTTGGGAGG + Intergenic
1061148739 9:128816824-128816846 CTCATGCCTGTAACTTTGGGAGG + Intergenic
1061208758 9:129178724-129178746 CTCCCGCGGGTCACTCGGGGGGG - Intergenic
1187879341 X:23831840-23831862 CTCATGCCTGTAACTTTGGGAGG - Intergenic
1190012878 X:46800509-46800531 CTCATGCCTGGCACTTTGGGAGG - Intergenic
1198327342 X:135586690-135586712 CTCAGGCCACTCACCCTGGGAGG - Intergenic
1199886354 X:152025381-152025403 CTCAGGCCTCTCTCTCAGGGAGG + Intergenic