ID: 1138497843

View in Genome Browser
Species Human (GRCh38)
Location 16:57419111-57419133
Sequence AGCCCCTGGGGACAGCGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138497843_1138497858 24 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497858 16:57419158-57419180 CTGCACTAGGCCTTGGGGCAGGG No data
1138497843_1138497859 25 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497859 16:57419159-57419181 TGCACTAGGCCTTGGGGCAGGGG No data
1138497843_1138497856 19 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497856 16:57419153-57419175 TGTAGCTGCACTAGGCCTTGGGG No data
1138497843_1138497853 11 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497843_1138497851 -5 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497843_1138497855 18 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497855 16:57419152-57419174 TTGTAGCTGCACTAGGCCTTGGG No data
1138497843_1138497854 17 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497854 16:57419151-57419173 GTTGTAGCTGCACTAGGCCTTGG No data
1138497843_1138497857 23 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497857 16:57419157-57419179 GCTGCACTAGGCCTTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138497843 Original CRISPR AGCCCCTGGGGACAGCGATG GGG (reversed) Intergenic