ID: 1138497851

View in Genome Browser
Species Human (GRCh38)
Location 16:57419129-57419151
Sequence GGGCTGGGATCAGCCACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138497838_1138497851 6 Left 1138497838 16:57419100-57419122 CCAGACTCCGGCCCCATCGCTGT No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497845_1138497851 -7 Left 1138497845 16:57419113-57419135 CCATCGCTGTCCCCAGGGGCTGG No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497831_1138497851 21 Left 1138497831 16:57419085-57419107 CCCTGACCCCACCAGCCAGACTC No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497830_1138497851 28 Left 1138497830 16:57419078-57419100 CCAGGGGCCCTGACCCCACCAGC No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497832_1138497851 20 Left 1138497832 16:57419086-57419108 CCTGACCCCACCAGCCAGACTCC No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497843_1138497851 -5 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497834_1138497851 15 Left 1138497834 16:57419091-57419113 CCCCACCAGCCAGACTCCGGCCC No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497839_1138497851 -1 Left 1138497839 16:57419107-57419129 CCGGCCCCATCGCTGTCCCCAGG No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497836_1138497851 13 Left 1138497836 16:57419093-57419115 CCACCAGCCAGACTCCGGCCCCA No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497835_1138497851 14 Left 1138497835 16:57419092-57419114 CCCACCAGCCAGACTCCGGCCCC No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497844_1138497851 -6 Left 1138497844 16:57419112-57419134 CCCATCGCTGTCCCCAGGGGCTG No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data
1138497837_1138497851 10 Left 1138497837 16:57419096-57419118 CCAGCCAGACTCCGGCCCCATCG No data
Right 1138497851 16:57419129-57419151 GGGCTGGGATCAGCCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138497851 Original CRISPR GGGCTGGGATCAGCCACATC TGG Intergenic