ID: 1138497853

View in Genome Browser
Species Human (GRCh38)
Location 16:57419145-57419167
Sequence CATCTGGTTGTAGCTGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138497850_1138497853 -3 Left 1138497850 16:57419125-57419147 CCAGGGGCTGGGATCAGCCACAT No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497837_1138497853 26 Left 1138497837 16:57419096-57419118 CCAGCCAGACTCCGGCCCCATCG No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497845_1138497853 9 Left 1138497845 16:57419113-57419135 CCATCGCTGTCCCCAGGGGCTGG No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497843_1138497853 11 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497849_1138497853 -2 Left 1138497849 16:57419124-57419146 CCCAGGGGCTGGGATCAGCCACA No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497848_1138497853 -1 Left 1138497848 16:57419123-57419145 CCCCAGGGGCTGGGATCAGCCAC No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497839_1138497853 15 Left 1138497839 16:57419107-57419129 CCGGCCCCATCGCTGTCCCCAGG No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497836_1138497853 29 Left 1138497836 16:57419093-57419115 CCACCAGCCAGACTCCGGCCCCA No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497835_1138497853 30 Left 1138497835 16:57419092-57419114 CCCACCAGCCAGACTCCGGCCCC No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497838_1138497853 22 Left 1138497838 16:57419100-57419122 CCAGACTCCGGCCCCATCGCTGT No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data
1138497844_1138497853 10 Left 1138497844 16:57419112-57419134 CCCATCGCTGTCCCCAGGGGCTG No data
Right 1138497853 16:57419145-57419167 CATCTGGTTGTAGCTGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138497853 Original CRISPR CATCTGGTTGTAGCTGCACT AGG Intergenic