ID: 1138497854

View in Genome Browser
Species Human (GRCh38)
Location 16:57419151-57419173
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138497845_1138497854 15 Left 1138497845 16:57419113-57419135 CCATCGCTGTCCCCAGGGGCTGG No data
Right 1138497854 16:57419151-57419173 GTTGTAGCTGCACTAGGCCTTGG No data
1138497850_1138497854 3 Left 1138497850 16:57419125-57419147 CCAGGGGCTGGGATCAGCCACAT No data
Right 1138497854 16:57419151-57419173 GTTGTAGCTGCACTAGGCCTTGG No data
1138497839_1138497854 21 Left 1138497839 16:57419107-57419129 CCGGCCCCATCGCTGTCCCCAGG No data
Right 1138497854 16:57419151-57419173 GTTGTAGCTGCACTAGGCCTTGG No data
1138497848_1138497854 5 Left 1138497848 16:57419123-57419145 CCCCAGGGGCTGGGATCAGCCAC No data
Right 1138497854 16:57419151-57419173 GTTGTAGCTGCACTAGGCCTTGG No data
1138497849_1138497854 4 Left 1138497849 16:57419124-57419146 CCCAGGGGCTGGGATCAGCCACA No data
Right 1138497854 16:57419151-57419173 GTTGTAGCTGCACTAGGCCTTGG No data
1138497843_1138497854 17 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497854 16:57419151-57419173 GTTGTAGCTGCACTAGGCCTTGG No data
1138497844_1138497854 16 Left 1138497844 16:57419112-57419134 CCCATCGCTGTCCCCAGGGGCTG No data
Right 1138497854 16:57419151-57419173 GTTGTAGCTGCACTAGGCCTTGG No data
1138497838_1138497854 28 Left 1138497838 16:57419100-57419122 CCAGACTCCGGCCCCATCGCTGT No data
Right 1138497854 16:57419151-57419173 GTTGTAGCTGCACTAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138497854 Original CRISPR GTTGTAGCTGCACTAGGCCT TGG Intergenic