ID: 1138497858

View in Genome Browser
Species Human (GRCh38)
Location 16:57419158-57419180
Sequence CTGCACTAGGCCTTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138497849_1138497858 11 Left 1138497849 16:57419124-57419146 CCCAGGGGCTGGGATCAGCCACA No data
Right 1138497858 16:57419158-57419180 CTGCACTAGGCCTTGGGGCAGGG No data
1138497843_1138497858 24 Left 1138497843 16:57419111-57419133 CCCCATCGCTGTCCCCAGGGGCT No data
Right 1138497858 16:57419158-57419180 CTGCACTAGGCCTTGGGGCAGGG No data
1138497850_1138497858 10 Left 1138497850 16:57419125-57419147 CCAGGGGCTGGGATCAGCCACAT No data
Right 1138497858 16:57419158-57419180 CTGCACTAGGCCTTGGGGCAGGG No data
1138497852_1138497858 -7 Left 1138497852 16:57419142-57419164 CCACATCTGGTTGTAGCTGCACT No data
Right 1138497858 16:57419158-57419180 CTGCACTAGGCCTTGGGGCAGGG No data
1138497844_1138497858 23 Left 1138497844 16:57419112-57419134 CCCATCGCTGTCCCCAGGGGCTG No data
Right 1138497858 16:57419158-57419180 CTGCACTAGGCCTTGGGGCAGGG No data
1138497848_1138497858 12 Left 1138497848 16:57419123-57419145 CCCCAGGGGCTGGGATCAGCCAC No data
Right 1138497858 16:57419158-57419180 CTGCACTAGGCCTTGGGGCAGGG No data
1138497839_1138497858 28 Left 1138497839 16:57419107-57419129 CCGGCCCCATCGCTGTCCCCAGG No data
Right 1138497858 16:57419158-57419180 CTGCACTAGGCCTTGGGGCAGGG No data
1138497845_1138497858 22 Left 1138497845 16:57419113-57419135 CCATCGCTGTCCCCAGGGGCTGG No data
Right 1138497858 16:57419158-57419180 CTGCACTAGGCCTTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138497858 Original CRISPR CTGCACTAGGCCTTGGGGCA GGG Intergenic