ID: 1138499039

View in Genome Browser
Species Human (GRCh38)
Location 16:57427228-57427250
Sequence CTCAGGATCTTACAAGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138499034_1138499039 3 Left 1138499034 16:57427202-57427224 CCTGGCACAGAAGACCGGGGCCT No data
Right 1138499039 16:57427228-57427250 CTCAGGATCTTACAAGGTGCCGG No data
1138499030_1138499039 11 Left 1138499030 16:57427194-57427216 CCAGGAGTCCTGGCACAGAAGAC No data
Right 1138499039 16:57427228-57427250 CTCAGGATCTTACAAGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138499039 Original CRISPR CTCAGGATCTTACAAGGTGC CGG Intergenic
No off target data available for this crispr